tgf POSTING
TGF-Beta
TNF
J Imm/140/2312
Espevik/87
reciprocal activation/regulation LAK activity
VIP
Fed Proc/37/657
Giachetti/78
Leidi/Robbins/88Endocrine/122/1652,Meigan G/88,Endocrine/123/1098,Fernande,89,Endocrine/125/1991,Sasaki/89,J Clin End Metabol/68/180?,Suhr/89,Mol End/3/1693
MAP
response to infections such as Reckettsia riketsii
J Pharm Science/91/1-7
Li, JD/03
This article highlights the novel takeover of a host cells respiratory cell netword
3-ab
NAD+/ATP?
PARP
brain res/829/46
takahashi/99
other inhib act to diminish stroke/Takahashi/99/inflamm dis/Chiarugi/00/circ shock/Mcdonald/00
receptor response to/exercise/inflammation/histamine/lactic acid/ Mg+2/bradykinin/K+/adenosine/H+
Dilation/arteriolar/tissue blood flow
sympathetic vasoconstriction at arteriolar level/ except via autoregulation
Clin Phys mad rediculously simple/3d ed/14
goldberg, stephen/99
This book has quite a few excellent drawingsand does make phys rediculously simple
chemical carcinogens
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
wik
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
CD25
tolerance/ self ags
autoimmunity if system is intact
J Immunol./155/1151–64
Sakaguchi S/ Sakaguchi N/Asano M,/95
Sakaguchi S, Sakaguchi N, Asano M, et al. Immunological self-tolerance maintained by activated T-cells expressing IL-2 receptor alpha-chain (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune-diseases. J Immunol. 1995/155:1151–64.
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
LAK cell
TGF-B reciprocal activation/regulation via
J Imm/140/2312
Espevik/87
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
megakaryocyte
IL8
Br J Haematol. /(3)/509-16.
higuchi, T/97
ito search
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
ornithine
LAK activity
NK cell activity/MS outcome
cell immun.
L-NAME / IL2/ NK cell
LAK cells
adeno CA (mice)
J Exp Med/164/814
Phillips JH/Lanier II/86
tnf
IL2 mediated NK - LAK conversion
chouaib/89
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
LGL-NK - LAK
IL2 mediated NK - LAK conversion
IL4/cAMP inhibition/(or)
j clin inves/85/6/1990
blay jy/90
hv/Hypovolemia**
thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++
strength in physical realm/+/pride/ego/self
Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/
God/?
+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani
ornithine
lak activity
arginase/*me/th2 prolif.
cell imm/132/451
arginase dec ornithine
Hypovolemia**
thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++
strength in physical realm/+/pride/ego/self
Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/
God/?
+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani
GLYCEROL KINASE
gENE DATA/TGTAATGCTGGTACAAGGCAGCTGGCAACGTTCCCTTCAAGACACAGAGGAGAAATCCAGATCATTCTC/atp MAKER
ATP
chemical carcinogens
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
wik
Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
crh Receptor - One stimulation
anxiety/anorexia
peace/food intake
brain res rev/15/71
hotta,m/99
sleep/ condition OSA
significant IL6 elevation in breath condensate
wakefulness
chest/122/4/1162
compagnano, ge/02
tgf-b
lak
phloretin
inhibition of muscle pO4lation
glucose uptake by RBC
dbr/13c/295
dbr/86
OXFORD PRESS
tgf-B
LAK
j imm/140/7312
Espevik/88
IL2
IL1/cAMP
LGL-LAK/IL4
J clin inves/85/6/1909
Chouaib,S/90
LT/ET
bA toxins/cAMP
PKA induced T-cell activation via /interuption of /intracellular signaling/MAPK*/MEK associated transcription factors/SAK p38/TCR events
trends immunology/27/9/434
baldari, cosima/06
erk1/erk2*
Initiator
Prod / Activ
Prod / Activ
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Functions
Wednesday, November 7, 2007
FUNUSITIS
Funisitis
Etiology•mostly bacteria •low virulence organisms , normal flora of vagina or •obvious pathogens such as E.Coli, Mycoplasma, Ureaplasma
Pathogenesis• bacteria ascending from vagina, breaching cervical defenses (mucus plug etc.) • bacterial colonization of intrauterine space through intact or ruptured membranes • maternal and fetal acute inflammatory response,
Epidemiology•clinically evident in 0.5-10% of pregnancies
General Gross Description•membranes and chorionic plate appear cloudy and occasionally have a yellow or green tint •in severe cases the umbilical cord may have small yellow round lesions on its surface which represent foci of PMN's (small abscesses)
General Microscopic Description•Chorioamnionitis: membranes (amnion and chorion + parietal decidua) show neutrophilic infiltrate. PMN's originate from maternal vessels in parietal decidua and migrate into chorion and then amnion. •Chorionitis: chorionic plate shows neutrophilic infiltrate. PMN's orginate from maternal intervillous space and migrate into subchorionic fibrin, chorion itself and then amnion •Funisitis: umbilical cord shows neutrophilic infiltrate. PMN's orginate in the fetal vessels of the umbilical cord and migrate sequentially through the muscular layers of the vessel and then into the Wharton's jelly. •Chorionic vasculitis: chorionic vessels show neutrophils in wall. PMN's originate in the fetal vessels of the chorionic plate and migrate through the walls of the fetal vessels toward the amniotic fluid
Clinical Correlation•associated with preterm birth •only 8-25% of mothers have symptoms such as fever, chills •fetus may have decreased biophysical profile score or abnormal heart rate pattern •can lead to congenital pneumonia, gastroenteritis, menigitis, sepsis although most infants do not have sepsis even with umbilical cord inflammation
References•Gibbs and Sweet "Maternal and Fetal Infections" (chapter 42) in Creasy and Resnik, Maternal Fetal Medicine: Principles and Practices 3rd edition; Philadelphia: WB Saunders, 1994, p644-646.
Funisitis
Umbilical Vasculitis - acute 10x
Obstetrics & Gynecology 2007;109:121-127 © 2007 by The American College of Obstetricians and Gynecologists
ORIGINAL RESEARCH
Maternal Serum Cytokines in Preterm Premature Rupture of Membranes
Amy P. Murtha, MD1, Tammy Sinclair, BSN1, Elizabeth R. Hauser, PhD2, Geeta K. Swamy, MD1, William N. P. Herbert, MD3 and R. Phillips Heine, MD1
From the 1Department of Obstetrics and Gynecology and 2Center for Human Genetics, Duke University Medical Center, Durham, North Carolina; and 3Department of Obstetrics and Gynecology, University of Virginia, Charlottesville, Virginia.
OBJECTIVE: To estimate whether maternal serum interleukin (IL)-6 or granulocyte colony-stimulating factor (G-CSF) obtained daily are elevated in women with preterm premature rupture of membranes who develop funisitis.
METHODS: Daily blood samples were obtained from women with preterm premature rupture of membranes and analyzed for IL-6 and G-CSF by enzyme-linked immunosorbent assay. Funisitis was determined by placental examination. Observations were stratified based on the presence or absence of funisitis and analyzed. Proportional hazards models were used to evaluate time-to-delivery on the basis of diagnostic IL-6 and G-CSF levels, determined by receiver operating characteristic curve analysis.
RESULTS: Of the 107 patients available for analysis, 54 (50%) had evidence of funisitis after delivery. Patients with funisitis were more likely to deliver at an earlier gestational age (28.5 weeks compared with 31.5 weeks, P<.001) and have Medicaid insurance (57% compared with 39%, P=.04). Serum IL-6 and G-CSF were elevated 24 to 48 hours before delivery in women with preterm premature rupture of membranes with funisitis compared with those without funisitis (IL-6, 7.5 compared with 2.8 pg/mL, P<.001; G-CSF, 121.7 compared with 56.9 pg/mL, P=.002). Using values identified by the receiver operating characteristic curve, elevated serum IL-6 in the interval 24–72 hours before delivery was significantly associated with funisitis (P<.03), even after controlling for gestational age and insurance status. CONCLUSION: Maternal serum IL-6 and G-CSF appear to be biomarkers in the identification of women with preterm premature rupture of membranes likely to develop funisitis. Immunol Today. 1989 Sep;10(9):299-304.
Links
Comment in:
Immunol Today. 1990 Mar;11(3):74.
The cytokine network.
Balkwill FR, Burke F.
The availability of pure recombinant cytokines and molecular probes for their genes has generated an avalanche of scientific information. These data show that cytokines have a broad and overlapping range of cell regulatory activity both in vitro and in vivo. New factors are added to the cytokine list, and new functions reported for existing cytokines, with such frequency that it is difficult to retain an overall picture. With this problem in mind, a large wallchart was designed and was displayed at the second meeting of the British Cytokine Group* whose members pooled their collective knowledge, to list the known biological activities of these cytokines. This wallchart of cytokine activity, now referenced, is reproduced for Immunology Today. It is not a final list: new information and cytokines are continually reported and space has been left for readers to make their own additions. A neutrophil-activating peptide variously named monocyte-derived neutrophil chemotactic factor (MDNCF), neutrophil-activating factor (NAF), lymphocyte-derived neutrophil-activating peptide (LYNAP), which has been suggested as a candidate for interleukin 8 (IL-8), is included.
ALL COMPLEMENTS OF AMIE
Etiology•mostly bacteria •low virulence organisms , normal flora of vagina or •obvious pathogens such as E.Coli, Mycoplasma, Ureaplasma
Pathogenesis• bacteria ascending from vagina, breaching cervical defenses (mucus plug etc.) • bacterial colonization of intrauterine space through intact or ruptured membranes • maternal and fetal acute inflammatory response,
Epidemiology•clinically evident in 0.5-10% of pregnancies
General Gross Description•membranes and chorionic plate appear cloudy and occasionally have a yellow or green tint •in severe cases the umbilical cord may have small yellow round lesions on its surface which represent foci of PMN's (small abscesses)
General Microscopic Description•Chorioamnionitis: membranes (amnion and chorion + parietal decidua) show neutrophilic infiltrate. PMN's originate from maternal vessels in parietal decidua and migrate into chorion and then amnion. •Chorionitis: chorionic plate shows neutrophilic infiltrate. PMN's orginate from maternal intervillous space and migrate into subchorionic fibrin, chorion itself and then amnion •Funisitis: umbilical cord shows neutrophilic infiltrate. PMN's orginate in the fetal vessels of the umbilical cord and migrate sequentially through the muscular layers of the vessel and then into the Wharton's jelly. •Chorionic vasculitis: chorionic vessels show neutrophils in wall. PMN's originate in the fetal vessels of the chorionic plate and migrate through the walls of the fetal vessels toward the amniotic fluid
Clinical Correlation•associated with preterm birth •only 8-25% of mothers have symptoms such as fever, chills •fetus may have decreased biophysical profile score or abnormal heart rate pattern •can lead to congenital pneumonia, gastroenteritis, menigitis, sepsis although most infants do not have sepsis even with umbilical cord inflammation
References•Gibbs and Sweet "Maternal and Fetal Infections" (chapter 42) in Creasy and Resnik, Maternal Fetal Medicine: Principles and Practices 3rd edition; Philadelphia: WB Saunders, 1994, p644-646.
Funisitis
Umbilical Vasculitis - acute 10x
Obstetrics & Gynecology 2007;109:121-127 © 2007 by The American College of Obstetricians and Gynecologists
ORIGINAL RESEARCH
Maternal Serum Cytokines in Preterm Premature Rupture of Membranes
Amy P. Murtha, MD1, Tammy Sinclair, BSN1, Elizabeth R. Hauser, PhD2, Geeta K. Swamy, MD1, William N. P. Herbert, MD3 and R. Phillips Heine, MD1
From the 1Department of Obstetrics and Gynecology and 2Center for Human Genetics, Duke University Medical Center, Durham, North Carolina; and 3Department of Obstetrics and Gynecology, University of Virginia, Charlottesville, Virginia.
OBJECTIVE: To estimate whether maternal serum interleukin (IL)-6 or granulocyte colony-stimulating factor (G-CSF) obtained daily are elevated in women with preterm premature rupture of membranes who develop funisitis.
METHODS: Daily blood samples were obtained from women with preterm premature rupture of membranes and analyzed for IL-6 and G-CSF by enzyme-linked immunosorbent assay. Funisitis was determined by placental examination. Observations were stratified based on the presence or absence of funisitis and analyzed. Proportional hazards models were used to evaluate time-to-delivery on the basis of diagnostic IL-6 and G-CSF levels, determined by receiver operating characteristic curve analysis.
RESULTS: Of the 107 patients available for analysis, 54 (50%) had evidence of funisitis after delivery. Patients with funisitis were more likely to deliver at an earlier gestational age (28.5 weeks compared with 31.5 weeks, P<.001) and have Medicaid insurance (57% compared with 39%, P=.04). Serum IL-6 and G-CSF were elevated 24 to 48 hours before delivery in women with preterm premature rupture of membranes with funisitis compared with those without funisitis (IL-6, 7.5 compared with 2.8 pg/mL, P<.001; G-CSF, 121.7 compared with 56.9 pg/mL, P=.002). Using values identified by the receiver operating characteristic curve, elevated serum IL-6 in the interval 24–72 hours before delivery was significantly associated with funisitis (P<.03), even after controlling for gestational age and insurance status. CONCLUSION: Maternal serum IL-6 and G-CSF appear to be biomarkers in the identification of women with preterm premature rupture of membranes likely to develop funisitis. Immunol Today. 1989 Sep;10(9):299-304.
Links
Comment in:
Immunol Today. 1990 Mar;11(3):74.
The cytokine network.
Balkwill FR, Burke F.
The availability of pure recombinant cytokines and molecular probes for their genes has generated an avalanche of scientific information. These data show that cytokines have a broad and overlapping range of cell regulatory activity both in vitro and in vivo. New factors are added to the cytokine list, and new functions reported for existing cytokines, with such frequency that it is difficult to retain an overall picture. With this problem in mind, a large wallchart was designed and was displayed at the second meeting of the British Cytokine Group* whose members pooled their collective knowledge, to list the known biological activities of these cytokines. This wallchart of cytokine activity, now referenced, is reproduced for Immunology Today. It is not a final list: new information and cytokines are continually reported and space has been left for readers to make their own additions. A neutrophil-activating peptide variously named monocyte-derived neutrophil chemotactic factor (MDNCF), neutrophil-activating factor (NAF), lymphocyte-derived neutrophil-activating peptide (LYNAP), which has been suggested as a candidate for interleukin 8 (IL-8), is included.
ALL COMPLEMENTS OF AMIE
AMIE JUSTIFICATION
We offer animated user friendly introductory interface (Aii) with links to a proprietary Query-Based Dual-Functioning Data-Base with Abbreviations and Data of Artificial Intelligence (QB DF DB AD AI) This will articulate with existing internet information for a tri-partate access to information.
In order to offer information from least to greatest detail available we begin with an animated 3d graphic front which articulates with our proprietary data-base which articulates with the www.
HISTORY / BACKGROUND
Medical data doubles every 3-5 years. Sometimes it is duplicated and rarely falsified. Access and verification of validity and relevance as to treatment utilizing new data as it is being developed is contingent upon the matrix/model (MM) pertaining to the disease or problem in question. The MM can have lumper or separator qualities namely finding commonality or differences between each other. A MM allows for lumping.The particular MM that the medically oriented individual was taught and is utilizing allows for the understanding of new concepts or ideas to be incorporated or disguarded in the MM. Lister went crazy trying to get a group of health care individuals to understand his MM of bacteria in disease and to wash their hands before surgery.
Their MM of disease was challenged .
The MM has traditionally been suggested as information published in textbooks or journals as articles. The MM is based on existing data and existing data’s relationship to itself. The relevance to the question itself is of altruistic intercessory quality (AIQ) for the most part in the hands of the researcher or caregiver or patient.
Current data points to a common Neuro-Humeral- Immune –Genome-INTEGRATED Function (NHIGIF) as it relates to a normal and disease states. Most of us realize that there is a SPIRITUAL coordination/connection/control associated with the NHIGIF .
For example prior to Fleming’s accidental discovery of PCN we had a leach and let (blood ) drag philosophy of medicine as far as infections are concerned. It was by back-tracing his actions and reposing the AIQ of bacterial growth that Fleming discovered that mold caused a reduction of growth in a particular bacterial colonies’ growth. After he purified the mold ….voila a cure was developed. Fleming changed our MM and thought process as to connect one organism’s growth with the decrease of growth in another. At this time we were discovering axels or drums, with the wheel being the microscope. Empiricism or sight-belief connection allowed for an entity to “exist” in our MM and hence be questioned as having or promoting a consequence.
Later on researchers discovered that these same organisms that stopped growing were in themselves a potential initiator of immune consequece (iiC) upon the NHIIF namely being manifested within our MM as a disease manifestation (DM) . If left untreated they led to NHIGIF pathology such as impetigo and glomerulonephritis which are disease leukemia ,MS, DM are just recently beginning to be thought of as an iiC consequences upon a MM of normal NHIGIF and its abnormal consequence being manifested as DM.
The genetic challenges to the NHIGIF were being studied by Stanislov Burzinski as they related to the genome and as the changes in the genome were iiC s acting upon a NHIGIF . Phenyl-acetate as an active principle can now be thought of as an iiC with positive consequences upon the NHIGIF.
A horse is hooked up to a buggy now and someone is thinking of inventing the horseless carriage.
The HIV epidemic has done the same thing with respect to helping us understand the matrix by which we understand the workings of NHIGIF. The decrease in NHIGIF seen in HIV consequential DM (AIDS) have given us insight into the workings of NHIGIF in general.. HIV is an iiC which I am sure all readers realize by now, yet it was by studying the NHIGIF DM and reposing the AIQ that the DM of HIV were realized in perspective to it being an iiC in relationship to NHIGIF. The consequence was that we gained insight into the workings of the normal NHIGIF . The equivalent propeller plane and wired telephone
A further example if that the Tuskeegee study was an attempt to study an iiC (syphilis ) and its NHIGIF DM
For example the over-abundance and pathology of NHIGIF is demonstrated when we die from diabetes as a result of too much tumor necrosis factor (TNF) a normal by-product of the NHIGIF . This is an NHIGIF gone awry. It is is on the other end of the continuum of NHIGIF from HIV as were mold and gram positive bacteria. I will hereby predict that as we “discover “ iiCs working upon a deficient Human Genome (HG) directed NHIGIF we will cure all disease in 3 years after the introduction of the correct MM
To further clarify we are talking about the “discovery” of different iiCs as to their effect on normal and abnormal NHIIF!!! This is the equivalent of the space shuttle with Wireless transmission of video and audio integrated broadcasting from space!!!!
MIs, strokes and cancer’s are pathologic states which are DMs consequencial to iiCs effect upon an increased or decreased normal NHIGIF Another way to put this: a series of events that causes an iiC to be introduced into the milieu of NHIGIF will either be normal or pathologic (increased or decreased ) contingent upon 1. amount of iiC,
2. length of time of exposure of iiC and 3. state of the NHIGIF in relationship to its MM
AMIE’s Raison d’Etre
AMIE is a Tri-partate TOOL invented for humanity that allows for insight and comparison/review of iiCs effect upon a proposed MM of normal NHIGIF in order to illucidate and prevent /cure DM and to suggest possibilities of iiCs.
The relationship to normal NHIGIF as a system allows us to develop proper preventative, dietary, and treatment perspectives only as they relate to the normal NHIGIF . Prediction : obscure diseases such as leukemias, Lupus, sarcoidosis, and autoimmune diseases such as essential hypertension, MS, thyroid abnormalites arthritis, diabetes will all be illucidated with the proper MM relating to the NHIGIF
MARKET
Anyone who is sick has a sick relative a sick loved one or one that they care for. Researchers and institutions of higher learning after paying a yearly fee , will be linked with potential patients who will be paid to participate. by the researchers. This will be contingent upon outcomes being likely to be positive. Higher institutions of learning will add to the data contingent upon their research interests. Individuals of educational pursuit will be allowed access at no charge if they make entries. Doctors, lawyers, patients, media persons, internship/resident physicians, attendings, researchers, fellows if not covered by the institutional fee will pay a yearly fee. Nursing students, PAs, nurse practitioners, medical assistants, nursing assistants will all be empowered with the availability of information from least to greatest detail should all have access via their respective institutions of higher learning.
We offer animated user friendly introductory interface (Aii) with links to a proprietary Query-Based Dual-Functioning Data-Base with Abbreviations and Data of Artificial Intelligence (QB DF DB AD AI) This will articulate with existing internet information for a tri-partate access to information.
In order to offer information from least to greatest detail available we begin with an animated 3d graphic front which articulates with our proprietary data-base which articulates with the www.
HISTORY / BACKGROUND
Medical data doubles every 3-5 years. Sometimes it is duplicated and rarely falsified. Access and verification of validity and relevance as to treatment utilizing new data as it is being developed is contingent upon the matrix/model (MM) pertaining to the disease or problem in question. The MM can have lumper or separator qualities namely finding commonality or differences between each other. A MM allows for lumping.The particular MM that the medically oriented individual was taught and is utilizing allows for the understanding of new concepts or ideas to be incorporated or disguarded in the MM. Lister went crazy trying to get a group of health care individuals to understand his MM of bacteria in disease and to wash their hands before surgery.
Their MM of disease was challenged .
The MM has traditionally been suggested as information published in textbooks or journals as articles. The MM is based on existing data and existing data’s relationship to itself. The relevance to the question itself is of altruistic intercessory quality (AIQ) for the most part in the hands of the researcher or caregiver or patient.
Current data points to a common Neuro-Humeral- Immune –Genome-INTEGRATED Function (NHIGIF) as it relates to a normal and disease states. Most of us realize that there is a SPIRITUAL coordination/connection/control associated with the NHIGIF .
For example prior to Fleming’s accidental discovery of PCN we had a leach and let (blood ) drag philosophy of medicine as far as infections are concerned. It was by back-tracing his actions and reposing the AIQ of bacterial growth that Fleming discovered that mold caused a reduction of growth in a particular bacterial colonies’ growth. After he purified the mold ….voila a cure was developed. Fleming changed our MM and thought process as to connect one organism’s growth with the decrease of growth in another. At this time we were discovering axels or drums, with the wheel being the microscope. Empiricism or sight-belief connection allowed for an entity to “exist” in our MM and hence be questioned as having or promoting a consequence.
Later on researchers discovered that these same organisms that stopped growing were in themselves a potential initiator of immune consequece (iiC) upon the NHIIF namely being manifested within our MM as a disease manifestation (DM) . If left untreated they led to NHIGIF pathology such as impetigo and glomerulonephritis which are disease leukemia ,MS, DM are just recently beginning to be thought of as an iiC consequences upon a MM of normal NHIGIF and its abnormal consequence being manifested as DM.
The genetic challenges to the NHIGIF were being studied by Stanislov Burzinski as they related to the genome and as the changes in the genome were iiC s acting upon a NHIGIF . Phenyl-acetate as an active principle can now be thought of as an iiC with positive consequences upon the NHIGIF.
A horse is hooked up to a buggy now and someone is thinking of inventing the horseless carriage.
The HIV epidemic has done the same thing with respect to helping us understand the matrix by which we understand the workings of NHIGIF. The decrease in NHIGIF seen in HIV consequential DM (AIDS) have given us insight into the workings of NHIGIF in general.. HIV is an iiC which I am sure all readers realize by now, yet it was by studying the NHIGIF DM and reposing the AIQ that the DM of HIV were realized in perspective to it being an iiC in relationship to NHIGIF. The consequence was that we gained insight into the workings of the normal NHIGIF . The equivalent propeller plane and wired telephone
A further example if that the Tuskeegee study was an attempt to study an iiC (syphilis ) and its NHIGIF DM
For example the over-abundance and pathology of NHIGIF is demonstrated when we die from diabetes as a result of too much tumor necrosis factor (TNF) a normal by-product of the NHIGIF . This is an NHIGIF gone awry. It is is on the other end of the continuum of NHIGIF from HIV as were mold and gram positive bacteria. I will hereby predict that as we “discover “ iiCs working upon a deficient Human Genome (HG) directed NHIGIF we will cure all disease in 3 years after the introduction of the correct MM
To further clarify we are talking about the “discovery” of different iiCs as to their effect on normal and abnormal NHIIF!!! This is the equivalent of the space shuttle with Wireless transmission of video and audio integrated broadcasting from space!!!!
MIs, strokes and cancer’s are pathologic states which are DMs consequencial to iiCs effect upon an increased or decreased normal NHIGIF Another way to put this: a series of events that causes an iiC to be introduced into the milieu of NHIGIF will either be normal or pathologic (increased or decreased ) contingent upon 1. amount of iiC,
2. length of time of exposure of iiC and 3. state of the NHIGIF in relationship to its MM
AMIE’s Raison d’Etre
AMIE is a Tri-partate TOOL invented for humanity that allows for insight and comparison/review of iiCs effect upon a proposed MM of normal NHIGIF in order to illucidate and prevent /cure DM and to suggest possibilities of iiCs.
The relationship to normal NHIGIF as a system allows us to develop proper preventative, dietary, and treatment perspectives only as they relate to the normal NHIGIF . Prediction : obscure diseases such as leukemias, Lupus, sarcoidosis, and autoimmune diseases such as essential hypertension, MS, thyroid abnormalites arthritis, diabetes will all be illucidated with the proper MM relating to the NHIGIF
MARKET
Anyone who is sick has a sick relative a sick loved one or one that they care for. Researchers and institutions of higher learning after paying a yearly fee , will be linked with potential patients who will be paid to participate. by the researchers. This will be contingent upon outcomes being likely to be positive. Higher institutions of learning will add to the data contingent upon their research interests. Individuals of educational pursuit will be allowed access at no charge if they make entries. Doctors, lawyers, patients, media persons, internship/resident physicians, attendings, researchers, fellows if not covered by the institutional fee will pay a yearly fee. Nursing students, PAs, nurse practitioners, medical assistants, nursing assistants will all be empowered with the availability of information from least to greatest detail should all have access via their respective institutions of higher learning.
renal
The following is a post related to renal physiology and renal failure in particular.
The current understanding with respect to the potential for renal failure to be improved without transplantation would be to grow a new kidney. This article deals with the pluripotetent cells that embryologically and genetically relate to functional renal activity post rabdomyolysis.
Renal Multipotent Progenitors = Initiator
It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowmans capsule. = Product Activity Increased
renal failure = Product activity Decreased
journal american society nephrology = Jnl
authors- Elena Lazzeri/Elisa Ronconi/Benedetta Mazzinghi/Costanza Sagrinati/Giuseppe Stefano Netti/Maria Lucia Angelotti/Eliana Parente/Lara Ballerini/Lorenzo Cosmi/Laura Maggi/Loreto Gesualdo/Mario Rotondi
/Francesco Annunziato/Enrico Maggi/Laura Lasagni/Mario Serio/Sergio Romagnani/Gabriella Barbara Vannelli
compliments of
AMIE
advanced medical informatics education
pete4doc@hotmail.com
Published ahead of print on October 31, 2007Journal of the American Society of Nephrology© 2007 American Society of Nephrologydoi: 10.1681/ASN.2007020210
Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure
Elena Lazzeri *, Clara Crescioli *, Elisa Ronconi *, Benedetta Mazzinghi *, Costanza Sagrinati *, Giuseppe Stefano Netti , Maria Lucia Angelotti *, Eliana Parente *, Lara Ballerini *, Lorenzo Cosmi *, Laura Maggi *, Loreto Gesualdo , Mario Rotondi * , Francesco Annunziato *, Enrico Maggi *, Laura Lasagni *, Mario Serio *, Sergio Romagnani *, Gabriella Barbara Vannelli , and Paola Romagnani *1
*Excellence Center for Research, Transfer and High Education for the Development of DE NOVO THERAPIES, and Department of Anatomy, University of Florence, Florence, Department of Biomedical Sciences, University of Foggia, Foggia, and Department of Endocrinology and Internal Medicine, Fondazione S. Maugeri Istituti di Ricovero e Cura a Carattere Scientifico, Pavia, Italy
Abstract
Bone marrow– and adult kidney–derived stem/progenitor cells hold promise in the development of therapies for renal failure. Here is reported the identification and characterization of renal multipotent progenitors in human embryonic kidneys that share CD24 and CD133 surface expression with adult renal progenitors and have the capacity for self-renewal and multilineage differentiation. It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowman’s capsule. When isolated and injected into SCID mice with acute renal failure from glycerol-induced rhabdomyolysis, these cells regenerated different portions of the nephron, reduced tissue necrosis and fibrosis, and significantly improved renal function. No tumorigenic potential was observed. It is concluded that CD24+CD133+ cells represent a subset of multipotent embryonic progenitors that persist in human kidneys from early stages of nephrogenesis. The ability of these cells to repair renal damage, together with their apparent lack of tumorigenicity, suggests their potential in the treatment of renal failure.
Prod / Activ Decrease
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Renal Multipotent Progenitors
It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowmans capsule.
renal failure
journal american society nephrology
Elena Lazzeri/Elisa Ronconi/Benedetta Mazzinghi/Costanza Sagrinati/Giuseppe Stefano Netti/Maria Lucia Angelotti/Eliana Parente/Lara Ballerini/Lorenzo Cosmi/Laura Maggi/Loreto Gesualdo/Mario Rotondi
/Francesco Annunziato/Enrico Maggi/Laura Lasagni/Mario Serio/Sergio Romagnani/Gabriella Barbara Vannelli
AMIE
advanced medical informatics education
pete4doc@hotmail.com
Published ahead of print on October 31, 2007Journal of the American Society of Nephrology© 2007 American Society of Nephrologydoi: 10.1681/ASN.2007020210
Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure
Elena Lazzeri *, Clara Crescioli *, Elisa Ronconi *, Benedetta Mazzinghi *, Costanza Sagrinati *, Giuseppe Stefano Netti , Maria Lucia Angelotti *, Eliana Parente *, Lara Ballerini *, Lorenzo Cosmi *, Laura Maggi *, Loreto Gesualdo , Mario Rotondi * , Francesco Annunziato *, Enrico Maggi *, Laura Lasagni *, Mario Serio *, Sergio Romagnani *, Gabriella Barbara Vannelli , and Paola Romagnani *1
*Excellence Center for Research, Transfer and High Education for the Development of DE NOVO THERAPIES, and Department of Anatomy, University of Florence, Florence, Department of Biomedical Sciences, University of Foggia, Foggia, and Department of Endocrinology and Internal Medicine, Fondazione S. Maugeri Istituti di Ricovero e Cura a Carattere Scientifico, Pavia, Italy
Abstract
Bone marrow– and adult kidney–derived stem/progenitor cells hold promise in the development of therapies for renal failure. Here is reported the identification and characterization of renal multipotent progenitors in human embryonic kidneys that share CD24 and CD133 surface expression with adult renal progenitors and have the capacity for self-renewal and multilineage differentiation. It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowman’s capsule. When isolated and injected into SCID mice with acute renal failure from glycerol-induced rhabdomyolysis, these cells regenerated different portions of the nephron, reduced tissue necrosis and fibrosis, and significantly improved renal function. No tumorigenic potential was observed. It is concluded that CD24+CD133+ cells represent a subset of multipotent embryonic progenitors that persist in human kidneys from early stages of nephrogenesis. The ability of these cells to repair renal damage, together with their apparent lack of tumorigenicity, suggests their potential in the treatment of renal failure.
A. Peters MD
The current understanding with respect to the potential for renal failure to be improved without transplantation would be to grow a new kidney. This article deals with the pluripotetent cells that embryologically and genetically relate to functional renal activity post rabdomyolysis.
Renal Multipotent Progenitors = Initiator
It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowmans capsule. = Product Activity Increased
renal failure = Product activity Decreased
journal american society nephrology = Jnl
authors- Elena Lazzeri/Elisa Ronconi/Benedetta Mazzinghi/Costanza Sagrinati/Giuseppe Stefano Netti/Maria Lucia Angelotti/Eliana Parente/Lara Ballerini/Lorenzo Cosmi/Laura Maggi/Loreto Gesualdo/Mario Rotondi
/Francesco Annunziato/Enrico Maggi/Laura Lasagni/Mario Serio/Sergio Romagnani/Gabriella Barbara Vannelli
compliments of
AMIE
advanced medical informatics education
pete4doc@hotmail.com
Published ahead of print on October 31, 2007Journal of the American Society of Nephrology© 2007 American Society of Nephrologydoi: 10.1681/ASN.2007020210
Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure
Elena Lazzeri *, Clara Crescioli *, Elisa Ronconi *, Benedetta Mazzinghi *, Costanza Sagrinati *, Giuseppe Stefano Netti , Maria Lucia Angelotti *, Eliana Parente *, Lara Ballerini *, Lorenzo Cosmi *, Laura Maggi *, Loreto Gesualdo , Mario Rotondi * , Francesco Annunziato *, Enrico Maggi *, Laura Lasagni *, Mario Serio *, Sergio Romagnani *, Gabriella Barbara Vannelli , and Paola Romagnani *1
*Excellence Center for Research, Transfer and High Education for the Development of DE NOVO THERAPIES, and Department of Anatomy, University of Florence, Florence, Department of Biomedical Sciences, University of Foggia, Foggia, and Department of Endocrinology and Internal Medicine, Fondazione S. Maugeri Istituti di Ricovero e Cura a Carattere Scientifico, Pavia, Italy
Abstract
Bone marrow– and adult kidney–derived stem/progenitor cells hold promise in the development of therapies for renal failure. Here is reported the identification and characterization of renal multipotent progenitors in human embryonic kidneys that share CD24 and CD133 surface expression with adult renal progenitors and have the capacity for self-renewal and multilineage differentiation. It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowman’s capsule. When isolated and injected into SCID mice with acute renal failure from glycerol-induced rhabdomyolysis, these cells regenerated different portions of the nephron, reduced tissue necrosis and fibrosis, and significantly improved renal function. No tumorigenic potential was observed. It is concluded that CD24+CD133+ cells represent a subset of multipotent embryonic progenitors that persist in human kidneys from early stages of nephrogenesis. The ability of these cells to repair renal damage, together with their apparent lack of tumorigenicity, suggests their potential in the treatment of renal failure.
Prod / Activ Decrease
Jnl / Vol / Pg
Author / Yr
Misc / Vol / Ed
Renal Multipotent Progenitors
It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowmans capsule.
renal failure
journal american society nephrology
Elena Lazzeri/Elisa Ronconi/Benedetta Mazzinghi/Costanza Sagrinati/Giuseppe Stefano Netti/Maria Lucia Angelotti/Eliana Parente/Lara Ballerini/Lorenzo Cosmi/Laura Maggi/Loreto Gesualdo/Mario Rotondi
/Francesco Annunziato/Enrico Maggi/Laura Lasagni/Mario Serio/Sergio Romagnani/Gabriella Barbara Vannelli
AMIE
advanced medical informatics education
pete4doc@hotmail.com
Published ahead of print on October 31, 2007Journal of the American Society of Nephrology© 2007 American Society of Nephrologydoi: 10.1681/ASN.2007020210
Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure
Elena Lazzeri *, Clara Crescioli *, Elisa Ronconi *, Benedetta Mazzinghi *, Costanza Sagrinati *, Giuseppe Stefano Netti , Maria Lucia Angelotti *, Eliana Parente *, Lara Ballerini *, Lorenzo Cosmi *, Laura Maggi *, Loreto Gesualdo , Mario Rotondi * , Francesco Annunziato *, Enrico Maggi *, Laura Lasagni *, Mario Serio *, Sergio Romagnani *, Gabriella Barbara Vannelli , and Paola Romagnani *1
*Excellence Center for Research, Transfer and High Education for the Development of DE NOVO THERAPIES, and Department of Anatomy, University of Florence, Florence, Department of Biomedical Sciences, University of Foggia, Foggia, and Department of Endocrinology and Internal Medicine, Fondazione S. Maugeri Istituti di Ricovero e Cura a Carattere Scientifico, Pavia, Italy
Abstract
Bone marrow– and adult kidney–derived stem/progenitor cells hold promise in the development of therapies for renal failure. Here is reported the identification and characterization of renal multipotent progenitors in human embryonic kidneys that share CD24 and CD133 surface expression with adult renal progenitors and have the capacity for self-renewal and multilineage differentiation. It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowman’s capsule. When isolated and injected into SCID mice with acute renal failure from glycerol-induced rhabdomyolysis, these cells regenerated different portions of the nephron, reduced tissue necrosis and fibrosis, and significantly improved renal function. No tumorigenic potential was observed. It is concluded that CD24+CD133+ cells represent a subset of multipotent embryonic progenitors that persist in human kidneys from early stages of nephrogenesis. The ability of these cells to repair renal damage, together with their apparent lack of tumorigenicity, suggests their potential in the treatment of renal failure.
A. Peters MD
Friday, September 28, 2007
conception
This is how the listings occur from an article to a post. What is does is use simple proportions to demonstrate definitions of certain concepts.
Do you see the going up and going down fields? These are help us define certain subjects.
Initiator Prod / Activ Prod / Activ Jnl / Vol / Pg Author / Yr Misc / Vol / Ed
conception immune reaction activation/TGF-B1/disabling of allergic reaction after fertilization/APC action rejection of foreign components
human conception/live birth Th2/immune reaction activation/TGF-B1/disabling of allergic reaction after fertilization/APC action rejection of foreign components/milagro/Th1 J Reprod Immunol./2/253-65 Robertson/2003 a cytokine present in abundance in seminal plasma, initiates this inflammatory response by stimulating the synthesis of pro-inflammatory cytokines and chemokines in uterine tissues.
Do you see the going up and going down fields? These are help us define certain subjects.
Initiator Prod / Activ Prod / Activ Jnl / Vol / Pg Author / Yr Misc / Vol / Ed
conception immune reaction activation/TGF-B1/disabling of allergic reaction after fertilization/APC action rejection of foreign components
human conception/live birth Th2/immune reaction activation/TGF-B1/disabling of allergic reaction after fertilization/APC action rejection of foreign components/milagro/Th1 J Reprod Immunol./2/253-65 Robertson/2003 a cytokine present in abundance in seminal plasma, initiates this inflammatory response by stimulating the synthesis of pro-inflammatory cytokines and chemokines in uterine tissues.
Subscribe to:
Posts (Atom)