<?xml version='1.0' encoding='UTF-8'?><?xml-stylesheet href="http://www.blogger.com/styles/atom.css" type="text/css"?><feed xmlns='http://www.w3.org/2005/Atom' xmlns:openSearch='http://a9.com/-/spec/opensearchrss/1.0/' xmlns:georss='http://www.georss.org/georss' xmlns:gd='http://schemas.google.com/g/2005' xmlns:thr='http://purl.org/syndication/thread/1.0'><id>tag:blogger.com,1999:blog-2280442141051223541</id><updated>2011-04-21T21:14:51.733-07:00</updated><category term='North Medical Center'/><category term='Interleukins'/><category term='quantitative analysis'/><category term='cytokine dysfuncion'/><category term='AMIE'/><category term='Sir Shambling Joe Medwick'/><category term='FUNUSITIS'/><category term='Don Robey'/><category term='713-699-4800'/><category term='Purpose'/><category term='Profession'/><category term='advanced medical informatics education'/><category term='En Espanol'/><category term='Disease cure'/><category term='cytokines'/><category term='713--524-6642'/><category term='freckles_r_sexy'/><category term='NeuroHumeral Immune system'/><category term='new treatment for metastic melanoma'/><category term='Bibleboost'/><category term='Alonzo Peters'/><category term='conception'/><category term='Alonzo Peters MD'/><category term='Immunology of freckles'/><category term='Drug war'/><category term='tutored by Don Wilkerson'/><category term='medico-legal'/><title type='text'>AMIE- advanced medical informatics and education</title><subtitle type='html'>This blog was created to share the information that is fractionated now into separate factions.  The Inflammatory Chain brings the parts into a whole that can be understood from conception unto death.</subtitle><link rel='http://schemas.google.com/g/2005#feed' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/posts/default'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default?max-results=100'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/'/><link rel='hub' href='http://pubsubhubbub.appspot.com/'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><generator version='7.00' uri='http://www.blogger.com'>Blogger</generator><openSearch:totalResults>27</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>100</openSearch:itemsPerPage><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-5815313576922406378</id><published>2008-02-20T14:08:00.000-08:00</published><updated>2008-02-20T22:06:07.503-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='cytokines'/><category scheme='http://www.blogger.com/atom/ns#' term='advanced medical informatics education'/><category scheme='http://www.blogger.com/atom/ns#' term='AMIE'/><title type='text'>Cytokine release</title><content type='html'>&lt;p&gt;Just recycling something that I did not know that I have &lt;/p&gt;&lt;p&gt; &lt;/p&gt;&lt;p&gt; &lt;/p&gt;&lt;br /&gt;&lt;br /&gt;&lt;object width="425" height="355"&gt;&lt;param name="movie" value="http://www.youtube.com/v/KiLJl3NwmpU&amp;rel=1&amp;border=0"&gt;&lt;/param&gt;&lt;param name="wmode" value="transparent"&gt;&lt;/param&gt;&lt;embed src="http://www.youtube.com/v/KiLJl3NwmpU&amp;rel=1&amp;border=0" type="application/x-shockwave-flash" wmode="transparent"width="425" height="355"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;br /&gt;&lt;br /&gt;Check this out&lt;br /&gt;&lt;br /&gt;Would you set this up if you could?&lt;br /&gt;call 713-882-7209&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-5815313576922406378?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/5815313576922406378/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=5815313576922406378' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5815313576922406378'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5815313576922406378'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/02/cytokine-release.html' title='Cytokine release'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-3394318998429191628</id><published>2008-02-17T16:32:00.000-08:00</published><updated>2008-02-20T22:11:34.589-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><category scheme='http://www.blogger.com/atom/ns#' term='713-699-4800'/><category scheme='http://www.blogger.com/atom/ns#' term='713--524-6642'/><title type='text'>Nanotech or no NO TECH?</title><content type='html'>&lt;a href="http://ptkalaichelvannotebook.blogspot.com/"&gt;http://ptkalaichelvannotebook.blogspot.com/&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;This blog forth coming gives some interesting explanations. A 1000th of a micron is a nanometer. Yet to know something exists in this amount and to measure it is one thing. Until we jointly understand the workings of the immune system before we go to manipulating, we are doomed. A typical example is the reduction of IFN -gamma upon the ingestion of melatonin. I could have told you that! You are really starting to mess up in trying to get some sleep and trying to be "natural". You will naturally dispose of yourself by a slow death.&lt;br /&gt;Anyway for the sake of enlightenment and in the name of science, I give you this blog and its address for future reference.&lt;br /&gt;&lt;a name="2875085663871042533"&gt;&lt;/a&gt;&lt;br /&gt;&lt;a href="http://ptkalaichelvannotebook.blogspot.com/2008/02/dear-students-i-happen-to-read-many.html"&gt;My students Nanotech info for this week&lt;/a&gt;&lt;br /&gt;Dear students I happen to read many interesting things on Nano and one of the sample i would like to share with you all...&lt;a href="http://www.nanotech-now.com/"&gt;http://www.nanotech-now.com/&lt;/a&gt;In the site an introductory stuff to beginer is presented very nicely...browse through the session and come prepared...It starts as"Truly revolutionary nanotechnology products, materials and applications, such as &lt;a href="http://www.nanowerk.com/spotlight/spotid=1730.php" target="new"&gt;nanorobotics&lt;/a&gt;, are years in the future (some say only a few years; some say many years). What qualifies as "nanotechnology" today is basic research and development that is happening in laboratories all over the world. "Nanotechnology" products that are on the market today are mostly gradually improved products (using evolutionary nanotechnology) where some form of nanotechnology enabled material (such as carbon nanotubes, nanocomposite structures or nanoparticles of a particular substance) or nanotechnology process (e.g. nanopatterning or quantum dots for medical imaging) is used in the manufacturing process. In their ongoing quest to improve existing products by creating smaller components and better performance materials, all at a lower cost, the number of companies that will manufacture "nanoproducts" (by this definition) will grow very fast and soon make up the majority of all companies across many industries. Evolutionary nanotechnology should therefore be viewed as a process that gradually will affect most companies and industries........"Have the habit of going through the latest trends in nanotechnology through internet&lt;br /&gt;Posted by DR.P.T.Kalaichelvan at &lt;a class="timestamp-link" title="permanent link" href="http://ptkalaichelvannotebook.blogspot.com/2008/02/dear-students-i-happen-to-read-many.html" rel="bookmark"&gt;9:42 AM&lt;/a&gt; &lt;a class="comment-link" onclick="" href="http://www.blogger.com/comment.g?blogID=5740580025425733418&amp;amp;postID=2875085663871042533"&gt;0 comments&lt;/a&gt; &lt;a title="Edit Post" href="http://www.blogger.com/post-edit.g?blogID=5740580025425733418&amp;amp;postID=2875085663871042533"&gt;&lt;/a&gt;&lt;br /&gt;Labels: &lt;a href="http://ptkalaichelvannotebook.blogspot.com/search/label/cas%20in%20botany" rel="tag"&gt;cas in botany&lt;/a&gt;, &lt;a href="http://ptkalaichelvannotebook.blogspot.com/search/label/chennai" rel="tag"&gt;chennai&lt;/a&gt;, &lt;a href="http://ptkalaichelvannotebook.blogspot.com/search/label/kalaichelvan" rel="tag"&gt;kalaichelvan&lt;/a&gt;, &lt;a href="http://ptkalaichelvannotebook.blogspot.com/search/label/madras%20university" rel="tag"&gt;madras university&lt;/a&gt;, &lt;a href="http://ptkalaichelvannotebook.blogspot.com/search/label/nano" rel="tag"&gt;nano&lt;/a&gt;, &lt;a href="http://ptkalaichelvannotebook.blogspot.com/search/label/nanotechnology.nano" rel="tag"&gt;nanotechnology.nano&lt;/a&gt;&lt;br /&gt;Thursday, January 24, 2008&lt;br /&gt;&lt;a name="6517677751756354439"&gt;&lt;/a&gt;&lt;br /&gt;&lt;a href="http://ptkalaichelvannotebook.blogspot.com/2008/01/size-matters-much-that-is-nano.html"&gt;Size matters much that is Nano&lt;/a&gt;&lt;br /&gt;SIZELet's start BIG to explain about Nano-sizeA meter is about the distance from the tip of your nose to the end of your hand (1 meter = 3.28 feet). One thousandth of that is a millimeter.Now take one thousandth of that, and you have a micron: a thousandth of a thousandth of a meter. Put another way: a micron is a millionth of a meter, which is the scale that is relevant to - for instance - building computers, computer memory, and logic devices.Let’s go smaller to the nanometerA nanometer is one thousandth of a micron, and a thousandth of a millionth of a meter (a billionth of a meter). Imagine: one billion nanometers in a meter.&lt;a href="http://www.nanotech-now.com/images/QDot-nanocrystal-size.jpg"&gt;&lt;/a&gt;Click image for larger version. Courtesy and © &lt;a href="http://www.qdots.com/" target="new"&gt;Quantum Dot Corporation&lt;/a&gt;Another perspective: a nanometer is about the width of six bonded carbon atoms, and approximately 40,000 are needed to equal the width of an average human hair. Another way to visualize a nanometer: 1 inch = 25,400,000 nanometers Red blood cells are ~7,000 nm in diameter, and ~2000 nm in heightWhite blood cells are ~10,000 nm in diameterA virus is ~100 nmA hydrogen atom is .1 nmNanoparticles range from 1 to 100 nmFullerenes (C60 / Buckyballs) are 1 nmQuantum Dots (of CdSe) are 8 nmDendrimers are ~10 nmDNA (width) is 2 nmProteins range from 5 to 50 nmViruses range from 75 to 100 nmBacteria range from 1,000 to 10,000 nmFor our purposes, nanometers pertain to science, technology, manufacturing, chemistry, health sciences, materials science, space programs, and engineering.Nanotechnology is the understanding and control of matter at dimensions of roughly 1 to 100 nanometers, where unique phenomena enable novel applications. Encompassing nanoscale science, engineering and technology, nanotechnology involves imaging, measuring, modeling, and manipulating matter at this length scale. At the nanoscale, the physical, chemical, and biological properties of materials differ in fundamental and valuable ways from the properties of individual atoms and molecules or bulk matter. Nanotechnology R&amp;amp;D is directed toward understanding and creating improved materials, devices, and systems that exploit these new properties. From &lt;a href="http://nano.gov/html/facts/whatIsNano.html" target="_blank"&gt;What is Nanotechnology?&lt;/a&gt;&lt;a href="http://micro.magnet.fsu.edu/primer/java/scienceopticsu/powersof10/" target="new"&gt;Powers of 10&lt;/a&gt; From 10-15 meters (a fermi), in steps of 10, to 10 -9 meters (nanometer), all the way out to 10 +16 meters (a lightyear), and finally, to 10 +23 meters (10 million light years). If you have not seen this really neat series of viewpoints, it can help to put scale into perspective! "View the Milky Way at 10 million light years from the Earth. Then move through space towards the Earth in successive orders of magnitude until you reach a tall oak tree just outside the buildings of the National High Magnetic Field Laboratory in Tallahassee, Florida. After that, begin to move from the actual size of a leaf into a microscopic world that reveals leaf cell walls, the cell nucleus, chromatin, DNA and finally, into the subatomic universe of electrons and protons." &lt;a href="http://www.newscientist.com/popups/guide_flash.jsp?sectionName=nanotechnology&amp;amp;sectionTitle=Nanotechnology&amp;amp;type=interactive&amp;amp;colour=000000" target="_blank"&gt;New Scientist&lt;/a&gt; has a great illustration on size.&lt;a href="http://www.nanotech-now.com/metric-prefix-table.htm"&gt;Metric Prefix Table&lt;/a&gt; &lt;a href="http://www.crmeng.com/units/UnitConversion.html" target="_blank"&gt;Units Conversion Tool 1&lt;/a&gt; &lt;a href="http://www.ex.ac.uk/cimt/dictunit/ccleng.htm" target="_blank"&gt;Units Conversion Tool 2&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://3.bp.blogspot.com/_1K_KaEu4xkk/R5l88oLFFII/AAAAAAAAAAQ/qw2dGfzUWOc/s1600-h/Scale%20of%20Nanotechnology.jpg"&gt;&lt;/a&gt;&lt;br /&gt;What is Nanotechnology? Nanotechnology is the act of purposefully manipulating matter at the atomic scale, otherwise known as the "nano-scale." Coined as "Nanotechnology" in a 1974 paper by Norio Taniguchi at the University of Tokyo, and encompassing a multitude of rapidly emerging technologies, based upon the scaling down of existing technologies to the next level of precision and miniaturization. Taniguchi approached nanotechnology from the 'top-down' standpoint, from the viewpoint of a precision engineer. Foresight Nanotech Institute Founder K. Eric Drexler introduced the term "nanotechnology" to the world in 1986, using it to describe a 'bottom-up' approach. Drexler approaches nanotechnology from the point-of-view of a physicist, and defines the term as "large-scale mechano-synthesis based on positional control of chemically reactive molecules." Broadly speaking however, Answers differ depending on who you ask, and their background.&lt;br /&gt;It uses a basic unit of measure called a "nanometer" (abbreviated nm). Derived from the Greek word for midget, "nano" is a metric prefix and indicates a billionth part (10-9). There are one billion nm's to a meter. Each nm is only three to five atoms wide. They're small. Very small. ~40,000 times smaller than the width of an average human hair. One aspect of nanotechnology is all about building working mechanisms using components with nanoscale dimensions (MNT), such as super small computers (think bacteria-sized) with today's MIPS capacity, or supercomputers the size of a sugar cube, possessing the power of a billion laptops, or a regular sized desktop model with the power of trillions of today's PC's. Some of the most promising potential of nanotechnology exists due to the laws of quantum physics. Quantum physics laws take over at this scale, enabling novel applications in optics, electronics, magnetic storage, computing, catalysts, and other areas. Regardless of the diverse opinions on the rate at which nanotechnology will be implemented, people who make it a habit of keeping up with technology advances agree on this: it is a technology in its infancy, and it holds the potential to change everything. Read this great Introduction from the Center for Responsible Nanotechnology for a better understanding of what nanotechnology is and is not, the social and business implications, and some steps being considered to control misuse. Related and interwoven fields include, but are not limited to: Nanomaterials, Nanomedicine, Nanobiotechnology, Nanolithography, Nanoelectronics, Nanomagnetics, Nanorobots, Biodevices (biomolecular machinery), AI, MEMS (MicroElectroMechanical Systems), NEMS (NanoElectroMechanical Systems), Biomimetic Materials, Microencapsulation, and many others.&lt;br /&gt;&lt;a href="http://localhost:3510/be1f40b007e3ebc2bdd3103acff72615/image183.jpg"&gt;&lt;/a&gt;&lt;br /&gt;Posted by DR.P.T.Kalaichelvan&lt;br /&gt;&lt;a href="http://ptkalaichelvannotebook.blogspot.com/search/label/ptkalai.ptk" rel="tag"&gt;ptkalai.ptk&lt;/a&gt;&lt;br /&gt;call 713-882-7209 for questions&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-3394318998429191628?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/3394318998429191628/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=3394318998429191628' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/3394318998429191628'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/3394318998429191628'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/02/nanotech-or-no-no-tech.html' title='Nanotech or no NO TECH?'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-1899871445131677086</id><published>2008-02-17T15:42:00.000-08:00</published><updated>2008-02-17T15:47:27.051-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><category scheme='http://www.blogger.com/atom/ns#' term='713-699-4800'/><category scheme='http://www.blogger.com/atom/ns#' term='713--524-6642'/><title type='text'>What started as a smile now gets serious</title><content type='html'>Neurofibromas vs. Freckles from a blog&lt;br /&gt;Check out the blog Childrens Network&lt;br /&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=get_topic;f=1;t=008613"&gt;http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=get_topic;f=1;t=008613&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;a name="000000"&gt;&lt;/a&gt;Dawnjoennikki98 Member Member # 14813&lt;br /&gt;posted September 09, 2007 09:53 PM &lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=get_profile;u=00014813" target="_blank"&gt;&lt;/a&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=email;ToWhom=00014813" target="_blank"&gt;&lt;/a&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=private_message;u=00014813"&gt;&lt;/a&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=edit_post;f=1;t=008613;reply_num=000000;u=00014813"&gt;&lt;/a&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=reply;f=1;t=008613;replyto=000000"&gt;&lt;/a&gt;&lt;br /&gt;I'm curious, what is the difference between a 5mm CAL and a large freckle? thanks!&lt;br /&gt;IP: &lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=get_ip;f=1;t=008613;reply_num=000000"&gt;Logged&lt;/a&gt;&lt;br /&gt;&lt;a name="000001"&gt;&lt;/a&gt;Orangecera Member Member # 7107&lt;br /&gt;posted September 09, 2007 11:24 PM &lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=get_profile;u=00007107" target="_blank"&gt;&lt;/a&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=private_message;u=00007107"&gt;&lt;/a&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=edit_post;f=1;t=008613;reply_num=000001;u=00007107"&gt;&lt;/a&gt;&lt;a href="http://www.ctf.org/cgi-bin/bb/ultimatebb.cgi?ubb=reply;f=1;t=008613;replyto=000001"&gt;&lt;/a&gt;&lt;br /&gt;I believe that there is actually no real difference as far as what they are "made of". A freckle is simply a "hyper-pigmented" or darker area of the skin, and that is what CAL's are. Both are simply a coloration of otherwise normal skin, caused I believe by the exact same chemical (it is called melanin or something like that isn't it?). So they are exactly the same thing - technically. However, freckles are a common coloration that are found particularly on people with fair skin, and I think they also run in families, and they are completely harmless, and from a large point of view "meaningless". And CAL's of course are a possible sign of NF, and therefore very "meaningful". Don't forget that about 10% of all people have 1 or 2 CAL's of "NF qualifying size", but of course nearly all people with only 1 or 2 CAL's are NF free. Now I don't know if a dermatologist would consider any "freckle" of a certain size to be a CAL and no longer a "freckle" or not. Anyone know?Does that answer your question? I think I was a bit confusing.&lt;br /&gt;713-882-7209&lt;br /&gt;formerly 713-699-4800&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-1899871445131677086?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/1899871445131677086/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=1899871445131677086' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/1899871445131677086'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/1899871445131677086'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/02/what-started-as-smile-now-gets-serious.html' title='What started as a smile now gets serious'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-4819024887839168967</id><published>2008-02-17T15:34:00.000-08:00</published><updated>2008-02-17T15:42:10.999-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='new treatment for metastic melanoma'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><category scheme='http://www.blogger.com/atom/ns#' term='713-699-4800'/><category scheme='http://www.blogger.com/atom/ns#' term='713--524-6642'/><title type='text'>New treatment for metastic melanoma. but watch those Freckles, or get someone else to.</title><content type='html'>The new treatment for metastic melanoma involves using cytokines, which are protein hormones of the immune system. The two cytokines that are used are interleukin-12 (IL-12), which stimulates production of interferon-gamma (IFN-g) in the body, and interferon-alpha (IFN-a). The IFN-g makes the body more receptive to the IFN-a which slows down growth of the tumor. This works better than if the IFN-a was only used. We found that in very high doses about 15 percent of the time it will actually make tumors shrink, even if they have spread through the body. Carson said.Research is about to embark on phase two of the trials. During phase one of the study patients were monitored to make sure they had no adverse effects to the cytokines. After the drugs are determined to be safe, the trial enters phase two. This stage monitors effects and evaluates effectiveness of the drugs. This is a national trial funded by the National Cancer Institute These are the kinds of things that provide new treatments to cancer patients, give our hospital experience in running national trials and brings some recognition to Ohio State, Carson said.&lt;br /&gt;Skin cancer, however, is a disease where risk can easily be reduced. Suggestions include; limiting exposure to the sun, wearing sun screen when in the sun and keeping an eye on moles and freckles that may change in color or size.Gary D. Stoner, professor and chair of environmental health sciences, said food also plays an important part in prevention. He said eating foods such as tomatoes, broccoli, onion, garlic and berries may drastically reduce the risk for cancer.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-4819024887839168967?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/4819024887839168967/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=4819024887839168967' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/4819024887839168967'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/4819024887839168967'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/02/new-treatment-for-metastic-melanoma-but.html' title='New treatment for metastic melanoma. but watch those Freckles, or get someone else to.'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-2295607056233856818</id><published>2008-02-17T15:04:00.001-08:00</published><updated>2008-02-17T15:34:15.575-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='freckles_r_sexy'/><category scheme='http://www.blogger.com/atom/ns#' term='Immunology of freckles'/><title type='text'>Freckles Are Sexy Si ou Non? freckles_R_sexy</title><content type='html'>&lt;a href="http://4.bp.blogspot.com/_oqRVF_DNKns/R7i9ulPPkNI/AAAAAAAAAVk/btI5oHjr7K8/s1600-h/freckles+r+sexy.jpg"&gt;&lt;img id="BLOGGER_PHOTO_ID_5168089180375322834" style="DISPLAY: block; MARGIN: 0px auto 10px; CURSOR: hand; TEXT-ALIGN: center" alt="" src="http://4.bp.blogspot.com/_oqRVF_DNKns/R7i9ulPPkNI/AAAAAAAAAVk/btI5oHjr7K8/s400/freckles+r+sexy.jpg" border="0" /&gt;&lt;/a&gt; This is just a little something I would check. This will be my first time at posting an immunologic add via AMIE attempting to first agree, but second to look into the immunologic manifestations of freckles. Beauty like this makes me only have more power in my cathexis of matters of the heart eg immunologic research. In any event if you can believe that she is 50, I may buy the bridge with you, but if she is , freckles may be a sign of longevity. Lets look into this. Let us try to begin at Google and quiz the wiz!&lt;br /&gt;The following is an article which lumped senile keratosis with freckles in an investigation into the known cytokines which stimulate freckle development. Let me give thanks ahead of time to the model and to the author and his company.&lt;br /&gt;&lt;strong&gt;&lt;/strong&gt;&lt;br /&gt;&lt;span style="color:#ff0000;"&gt;&lt;strong&gt;Title: &lt;/strong&gt;Prevention of Pigment Spots: Strategy for Future Prevention with Respect to Cellular Actions.&lt;br /&gt;&lt;/span&gt;&lt;strong&gt;Abstract; &lt;/strong&gt;Recently, paracrine cytokine linkage plays an essential role in the accentuated pigmentation in the epidermis by secreting by keratinocytes or fibroblasts and responding by melanocytes to various melanogenic cytokines. In UVB or UVA-induced pigmentation as well as in non-UV-associated epidermal pigmentary disorders such as senile freckles, seborrhoeic keratosis and dermato-fibroma, specific melanogenic cytokines have been shown to be intrinsic cytokines responsible for stimulating melanocyte function leading to each hyperpigmentation. Furthermore, it has been reported that there are several crosstalks between melanogenic cytokines in intracellular signalling pathways for eliciting a synergistic stimulatory effect on melanocytes. Therefore, it will be an ideal strategy to interrupt the signalling pathways at specific sites by which the ability of melanocytes to proliferate and to synthesize melanin is abolished to a normal control level, resulting in the prevention of the pigmentation.&lt;br /&gt;Journal of Japanese Cosmetic Science Society,VOL.24;NO.1;PAGE.29-34, 2000&lt;br /&gt;Author:IMOKAWA GENJI&lt;br /&gt;And from Dar Clark's review. I like it!&lt;br /&gt;&lt;br /&gt;Melanocytes&lt;br /&gt;Intercalated in among the basal cells; the basement membrane is beneath "all these guys." Each melanocyte reaches out to about 36 keratnocytes. The melanocytes make the pigment but they then transfer that pigment to the keratnocytes. It is then the keratnocytes which contain the pigment to give you skin color.&lt;br /&gt;Vitiligo&lt;br /&gt;Melanocytes are destroyed by t-cells (autoimmune disease). It is associated with other autoimmune diseases such as hypothyroidism, Addison's disease and pernicious anemia, all of which give you syndrome complexes. Total drop out of melanocytes within a lesion of vilitiligo is quite different from that in albinism.&lt;br /&gt;Albinism&lt;br /&gt;Melanocytes are there but they do not make pigment for all kinds of reasons. It exists in just about every animal species (see Robbins, "One of those little boxes").&lt;br /&gt;Lentigo&lt;br /&gt;Proliferation of melanocytes singly disposed along basement membrane in a young child. These are not freckles. Biopsies of freckles show nothing really abnormal. Same number of melanocytes seemingly making the same amount of melanin. No one know what causes freckles.&lt;br /&gt;Moles&lt;br /&gt;Not a furry little animal. Moles are proliferations of melanocytic nevi but in nests at the basement membrane. They give you a junctional nevus and with time they migrate down into the dermis and make a compound nevus and finally and they form finally an interdermal nevus. As they migrate down they lose their ability to make pigment and thus get lighter in color: this is the normal life of a "mole." They make nice even cords. In melanoma, regardless of the layer of skin it is in, the nests are very bizarre looking&lt;br /&gt;Langerhans cells&lt;br /&gt;These are the macrophages of the skin. They are antigen presenting cells and are the basis of contact dermatitis. Langerhans cells capture antigens in epidermis and then travel down through the dermis, up the lymphatics and into the local lymph nodes where they present antigens. They do not live in the epidermis forever; they migrate on.&lt;br /&gt;When you get exposed to something like poison ivy, lymph cells, which are always percolating around, recognize and release a set of cytokines which call in more lymphocytes and turns on keratnocytes. These keratnocytes are very important in this process for they are responsible for releasing cytokines. These released cytokines stimulate the epithelium which then express aggresin so that the lymphocytes know where to go. This doesn't just happen in the skin; the skin is just one example for lymphocyte homing.&lt;br /&gt;Desmosomes&lt;br /&gt;Desmosomes link the keratnocytes together. It is mostly the linkage between the cells in the spinous layer which give you the real strength of the epidermis. If there are no desmosomes, like in pemphigus, it all just falls apart. In this disease the patients make antibodies to the desmosomes in which case the desmosomes fall apart and so does the skin.&lt;br /&gt;Images were shown of the proteins linking half a desmosome of one cell to half a desmosome of another to make a full desmosome. Shown on EM we can see the keratin filaments on the cytoplasmic face of the desmosome. We can see how the keratin filaments inside the cell act as clotheslines to add strength to the epidermis. You can see the spaces between adjacent keratin filaments. The proteins linking the desmosomes together are desmogleans and desmocollins. The antigen in pemphigus is almost always desmoglean III (sometimes desmoglean I).&lt;br /&gt;Immunofluoroesence of skin was shown of a patient with pemphigus. In it was shown basal cells still attached because there is no rupture of the basal cells off of the basement membrane. Pathologists call these "tombstones" (friggin' pathologists). In acantholysis the keratnocytes are "rounded up" in the stratum corneum.&lt;br /&gt;As the keratnocytes mature up into the granular cell layer they still have desmosomes but now they start to make granules (lamellar bodies and keratohyalin granules). Through electromicroscopy, lamellar bodies appear to be very similar to lamellar bodies found in the synovium, lung, cornea. They have bilayers of different types of lipid. Lipids contained in the lamellar bodies of the skin are cholesterol sulfate, free fatty acid and ceramides. Alternatively, the major of the lung is surfactant.&lt;br /&gt;When keratnocytes mature into corneocytes the lamellar bodies are released upon which the cholesterol sulfates, free fatty acids and ceramides come together to make one gigantic complex of cholesterol, fatty acids and ceramides. There are no free fatty acids nor cholesterol sulfate in these complexes. In excallen icthiosis patients do not make cholesterol sulfatase and so they can't take the sulfate off of the cholesterol which inhibits the big complex from being made. As a result, scales form because the permeability barrier does not form well and the ability of the stratum corneum to shed is disrupted as well.&lt;br /&gt;The other component which allows epidermis to shed properly is a natural moisturizing factor. It is a breakdown product of fillangrin made in the keratohyalin granules. This factor is hydroscopic and thus pulls in water. Without this factor, the enzymes which break down desmosomes do not work properly and because of all of this, scales form. During winter seasons, the combined effects of low humidity, wind and low temperatures will inhibit these same enzymes.&lt;br /&gt;Xeroderma&lt;br /&gt;There are lots of causes of xeroderma, including soaps and detergents.&lt;br /&gt;Ichthyosis&lt;br /&gt;We are not responsible to know the types of ichtyposis but he wants us to understand that there are a set of genodermatoses that lead to lots of scales and dry skin because they lock up the skin's ability to make this permeability barrier and natural moisturizing factor.&lt;br /&gt;Test answer note:&lt;br /&gt;we will not see excallen icthiosis nor will we need to know the specific names of these enzymes just discussed.&lt;br /&gt;Psoriasis&lt;br /&gt;In psoriasis the skin turns over really fast (normal: 28 days; psoriasis: 1/wk) and they leave trails of scales (sounds like a new song title). They make stratum corneum so fast that the enzymes which break down the desmosomes simply cannot keep up. As a result, the skin does not mature properly. This is why patients with psoriasis and excema have scales. Eczema is a hyperproliferative disease, also probably due to an autoimmune (T-cell) problem. Psoriasis is a reaction to cytokines which get released when t-cells attack the epidermis.&lt;br /&gt;Excema&lt;br /&gt;There are a variety of excemas. In contact dermatitis the skin is an innocent bystander. The lymphocytes get through the epidermis and beat up the keratnocytes along with the antigens they are after. Allergic contact dermatitis is not a direct assault on the epidermis, its just an allergic reaction that hits the epidermis. The same is true for atopic dermatitis. In atopic dermatitis, the whole protein antigen is present as opposed to allergic contact dermatitic which is a response to haptens. Whole proteins include things like pollen, mite feces and animal dandruffs.&lt;br /&gt;Suberyp dermatitis&lt;br /&gt;With the aids epidemic it became clear that the inciting agent there turned out to be an inflammatory reaction (probably an immune response) to pitiform ovale, a fungus that normally lives on the skin. In patients with AIDS this fungus overgrows from which they get an antibody complement mediated response (t-cell).&lt;br /&gt;Even very severe dry skin can cause eczema just because it is irritating to have very dry skin.&lt;br /&gt;Epidermal-dermal junction/interface&lt;br /&gt;The epidermis is attached to the dermis through a basement membrane called the epidermal-dermal junction/interface. This is made up of a bunch of proteins (mostly bullous pemphigoid antigen- there are two of these but we don't need to know them separately). The others are lamannin, Type 4 collagen, and heparinsulfate proteoglycans. Note to remember: the fibrillar collagens (types 1-3) are like link-enlogs which make big strong bundles. Type 4 collagen is very different, it makes a sort of basket-weave. Type 4 collagen runs parallel with the skin making a net-like basket weave.&lt;br /&gt;Bullous pemphigoid&lt;br /&gt;Patients with this disease make an antibody to the bullous pemphigoid antigen proteins. This reaction causes a lot of inflammation and a split under the epidermis right through the basement membrane. This leaves tense bullae. I did not get this part straight: This is different from flaccid bullae which are a result of pemphigus because in pemphigus the whole skin is falling apart…sorry. Anyway, there is a difference between 'pemphigus' and 'pemphigoid.' An immunofluoresence image was shown illustrating the linear appearance of bullous pemphigoid.&lt;br /&gt;Basal cell carcinomas&lt;br /&gt;YOU MUST KNOW WHAT A PEARLY PAPULE BASAL CELL CARCINOMA LOOKS LIKE. "There is nothin' else that looks like this."&lt;br /&gt;Sometimes a basal cell carcinoma can be pretty subtle. The pearliness is due to light reflection. The light reflection results from a total effacement of all the skin markings. The skin markings are gone because the tumor has replaced them. Sometimes specs of pigment can be seen within the borders of the tumor and this may through you off track but, if you "erase" the pigment you have a shiny, pearly plaque left. All of the markings have been effaced. Basal cell carcinomas are the most common cancer…period. They are fairly harmless if you catch and treat them. Of course if the patient never comes in, she may lose her entire upper lip on Thanks Giving day. So, these tumors are invasive and can even get as far as the brain. But, BASAL CELL CARCINOMAS DO NOT METASTASIZE and if treated they have no effect locally. Basal cell carcinomas are VERY well organized tumors.&lt;br /&gt;Squamous cell carcinoma of the skin&lt;br /&gt;SQUAMOUS CELL CARCINOMAs OF THE SKIN TEND NOT TO METASTASIZE with the major exceptions being those which appear on the lip or in a scar: these have a much greater chance of metastasizing. The abnormal cells usually span the entire depth of the epidermis but there is still a basement membrane.&lt;br /&gt;Actinic keratosis&lt;br /&gt;These are precursor lesions to nothing or, to squamous cell carcinoma: 1/25 of these just go away whereas 1/100 progress to squamous cell carcinoma. In places like good 'ole L.I., Florida and Hawaii, people will have hundreds of these actinic keratosis lesions. They can be all over the sun exposed areas of skin. They are treated with either topical 5-fluorouracil or they get frozen. Those that are not clear are biopsied. The abnormal cells don't quite make it through the entire depth of the epidermis. They tend to be localized more towards the bottom of the epidermis: very characteristic.&lt;br /&gt;'actinic' » sun&lt;a name="paste"&gt;&lt;/a&gt;&lt;br /&gt;'keratosis' » "rough spot"&lt;br /&gt;Melanoma&lt;br /&gt;Appear with scalloped boarders and with irregular variations in color. The image he showed included the 'sign of regression.' There may also be a nodular component which would appear raised. Melanomas grow in bizarre, "helter-skelter" arranged nests and as singly disposed melanocytes "all over the place," not just along the basement membrane like in lentigo "helter-skelter is a red flag for cancer." The cells and nests vary from one to the next. Dermal nevi (not melanomas) growth in nice little cords, not in a mess like with melanomas. Two growth phases are described the first being radial and the second, vertical. The melanomas which start the vertical growth phases early become nodular melanomas and are deadly. Most grow radially for weeks, months or years before they begin to grow vertically. If caught early, these patients with "superficial spreading melanoma" can be cured by simple excision.&lt;br /&gt;Dermatomyositis&lt;br /&gt;One of the more unusual kinds of connective tissue diseases. It is characterized by some unusual rheumatologic features and symmetric proximal muscle weakness. Diagnosis includes myocytal enzymes, EMG changes and inflammation.&lt;br /&gt;A heliotrope was shown (???)&lt;br /&gt;Scaly erythematous plaques and papules are characteristic: neutron papules. When these same kinds of lesions exist between the joints then it is a sign of lupus and then are not called neutron papules either instead, they are called discoid lupus lesions. Thus, the placement is very important when it comes to these scaly papules on patient's hands who you think have connective tissue disease.&lt;br /&gt;Periungal telangiectasia due to capillary drop out and compensatory dilatation of residual capillaries. Periungal telangiectasia can be seen in dermatomyositis, scleroderma and lupus. It sign a good sign to tell of a connective tissue disease but it is a terrible sign to tell you what kind of connective tissue disease it is.&lt;br /&gt;In scleroderma, the sclerosis is throughout the entire skin including the subcutaneous tissue. This is why it is so bound down. They have lost all of their padding and they get ulcers easily over their knuckles and finger tips.&lt;br /&gt;Diffuse cutaneous sclerosis and limited sclerosis are symmetric diseases. The localized sclerosis is asymmetric. They can be down arms and legs. One patient will usually have it only on one side. They too have joint contracture and limited mobility in the involved joints because the sclerosis goes right through the skin and into muscle (I AM NOT SURE THAT I GOT THIS RIGHT!!!)&lt;br /&gt;Palpable purpura&lt;br /&gt;First, you need to know if there is any underlying disease like lupus or another connective tissue disease like rheumatoid arthritis or others or, if it is drug related. If this were a drug related vasculitis, the most common would be cutaneous lymphcytoplastic vasculitis. Always get a urinalysis for RBCs and always get a stool for occult blood. These tests will help to rule out two big organs that get hit with other diseases: microangiitis and micropolyarteritis. The differentiation between cutaneous lymphcytoplastic vasculitis and microscopic angiitis (microscopic polyarteriitis) is not well written in Robbins at all. Robbins may lead you to think that the microangiitis commonly affects all the organs and that is "clearly not the case."&lt;br /&gt;Palpable purpura is associated with wide spread disease in all body organs resulting in bleeding in the bowel, hemoptysis, and glomerular nephritis. These are not blanchable. Palpable purpura is a primary vasiculitis with secondary inflammation of the fat.&lt;br /&gt;polyarteritis nodosa&lt;br /&gt;Next up was an image showing the deeper lesions of polyarteritis nodosa which aren't blanchable either. There is a big differential with erythema nodosa. It is a piniculitis in response to a ___?____ and you will see mostly beta strep throat; this is a very common thing.&lt;br /&gt;Patients with polyarteritis nodosa do not get glomerular nephritis like those with micropolyarteritis do. Again, it is in Robbins. These patients (PAN) get renal hypertension. Polyarteritis nodosa is one of the most confusing diseases you will ever run into. It often doesn't even have any skin signs at all. Patients will just present with some bizarre complaints. In polyarteritis nodosa there is a primary inflammation of the fat with secondary vasculitis.&lt;br /&gt;Henloch-Schloen Purpura&lt;br /&gt;In younger people with red cells in their urine or stools be sure to consider Henloch-Schloen Purpura and do immunoflouresence either on the early lesion on the skin looking for immune complexes (the biopsy must be done on an early lesion to see the IgA) or do a kidney biopsy and again, look for the IgA immune complexes. Most people with Henloch-Schloen Purpura also do fine.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.epicrecords.com/epiccenter/custom/1173/audio/absolutely.wav"&gt;http://www.epicrecords.com/epiccenter/custom/1173/audio/absolutely.wav&lt;/a&gt;&lt;br /&gt;&lt;p&gt;&lt;/p&gt;&lt;p&gt;And from too much in a spot to too little all over.........&lt;/p&gt;&lt;p&gt;&lt;br /&gt;Vitiligo: A Manifestation of Apoptosis?&lt;br /&gt;Current Opinion American Journal of Clinical Dermatology. 3(5):301-308, 2002.Huang, Carol L.; Nordlund, James J.; Boissy, Raymond&lt;br /&gt;Abstract: Vitiligo is a common cutaneous disorder that has significant biological and social consequences for those affected. It is characterized by a loss of melanocytes from the epidermis, which results in the absence of melanin, i.e. depigmentation. There are numerous hypotheses about the etiology of vitiligo, but no data to definitively prove one theory over another. It is likely that there are numerous causes for the loss of these melanocytes.&lt;br /&gt;One way to approach the identification of the etiology is to determine the mechanism by which the melanocytes are destroyed. The two known mechanisms for the destruction of cells are necrosis and apoptosis. One purpose of this paper is to review the extant data that might suggest which of the two mechanisms is operative against melanocytes in patients with vitiligo. The histological data, and some laboratory data, support apoptosis, rather than necrosis, as the mechanism for removal of melanocytes. Apoptosis can be induced by a variety of factors, including immune cytokines, some environmental chemicals (for example substituted hydroquinones such as monobenzone) or other molecular mechanisms. Current therapies, such as corticosteroids and ultraviolet light, do affect apoptosis in a variety of ways.&lt;br /&gt;Confirmation of apoptosis as a mechanism, and identification of how apoptosis is initiated to produce vitiligo, can serve as a basis for devising medications that might stop the progression of the disorder. The problem of vitiligo would be essentially solved if there was a medication that is well tolerated in children, adults and pregnant women, and that would halt the progression of the depigmentation. The study of apoptosis, mechanisms of its induction, and the ways to block apoptosis, is one possible way to find both the causes of depigmentation and medications to prevent its progression.&lt;br /&gt;&lt;br /&gt;&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-2295607056233856818?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/2295607056233856818/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=2295607056233856818' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2295607056233856818'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2295607056233856818'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/02/blog-post.html' title='Freckles Are Sexy Si ou Non? freckles_R_sexy'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/_oqRVF_DNKns/R7i9ulPPkNI/AAAAAAAAAVk/btI5oHjr7K8/s72-c/freckles+r+sexy.jpg' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-213326233331571148</id><published>2008-02-04T18:04:00.000-08:00</published><updated>2008-02-04T18:19:55.167-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='NeuroHumeral Immune system'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><title type='text'>3d images</title><content type='html'>&lt;object width="320" height="266" class="BLOG_video_class" id="BLOG_video-24fc081db8fd8614" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,40,0"&gt;&lt;param name="movie" value="http://www.youtube.com/get_player"&gt;&lt;param name="bgcolor" value="#FFFFFF"&gt;&lt;param name="allowfullscreen" value="true"&gt;&lt;param name="flashvars" value="flvurl=http://v18.nonxt3.googlevideo.com/videoplayback?id%3D24fc081db8fd8614%26itag%3D5%26app%3Dblogger%26ip%3D0.0.0.0%26ipbits%3D0%26expire%3D1331504994%26sparams%3Did,itag,ip,ipbits,expire%26signature%3D3DAE71A49EBB9657C2BA762232A2EF4E1D505BBA.7122138F7045E9F427998E9511C1C7A01144128F%26key%3Dck1&amp;amp;iurl=http://video.google.com/ThumbnailServer2?app%3Dblogger%26contentid%3D24fc081db8fd8614%26offsetms%3D5000%26itag%3Dw160%26sigh%3DgRzHjBaIhONfLw4dA_C3A5bLLgE&amp;amp;autoplay=0&amp;amp;ps=blogger"&gt;&lt;embed src="http://www.youtube.com/get_player" type="application/x-shockwave-flash"width="320" height="266" bgcolor="#FFFFFF"flashvars="flvurl=http://v18.nonxt3.googlevideo.com/videoplayback?id%3D24fc081db8fd8614%26itag%3D5%26app%3Dblogger%26ip%3D0.0.0.0%26ipbits%3D0%26expire%3D1331504994%26sparams%3Did,itag,ip,ipbits,expire%26signature%3D3DAE71A49EBB9657C2BA762232A2EF4E1D505BBA.7122138F7045E9F427998E9511C1C7A01144128F%26key%3Dck1&amp;iurl=http://video.google.com/ThumbnailServer2?app%3Dblogger%26contentid%3D24fc081db8fd8614%26offsetms%3D5000%26itag%3Dw160%26sigh%3DgRzHjBaIhONfLw4dA_C3A5bLLgE&amp;autoplay=0&amp;ps=blogger"allowFullScreen="true" /&gt;&lt;/object&gt;Non Phosphorylated Brain&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-213326233331571148?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='enclosure' type='video/mp4' href='http://www.blogger.com/video-play.mp4?contentId=24fc081db8fd8614&amp;type=video%2Fmp4' length='0'/><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/213326233331571148/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=213326233331571148' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/213326233331571148'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/213326233331571148'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/02/3d-images.html' title='3d images'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-5163053183634363356</id><published>2008-02-04T17:50:00.000-08:00</published><updated>2008-02-04T18:02:16.933-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><title type='text'>Three D images of Brain's striatum</title><content type='html'>This is the new thing to present to you.  I will tell you later how this will be related to the Neuro Humeral Immune Informatic database&lt;br /&gt;&lt;object width="320" height="266" class="BLOG_video_class" id="BLOG_video-82e2b698bd739ad4" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,40,0"&gt;&lt;param name="movie" value="http://www.youtube.com/get_player"&gt;&lt;param name="bgcolor" value="#FFFFFF"&gt;&lt;param name="allowfullscreen" value="true"&gt;&lt;param name="flashvars" value="flvurl=http://v22.nonxt4.googlevideo.com/videoplayback?id%3D82e2b698bd739ad4%26itag%3D5%26app%3Dblogger%26ip%3D0.0.0.0%26ipbits%3D0%26expire%3D1331504994%26sparams%3Did,itag,ip,ipbits,expire%26signature%3D8711EE7E8C476656B166F482A27EBE96555429F.2CD273E8A1F26492A0EB82DD5B82EA40A88B6BA4%26key%3Dck1&amp;amp;iurl=http://video.google.com/ThumbnailServer2?app%3Dblogger%26contentid%3D82e2b698bd739ad4%26offsetms%3D5000%26itag%3Dw160%26sigh%3D1yRoqMgk5g-yB051l3w79UK6zmY&amp;amp;autoplay=0&amp;amp;ps=blogger"&gt;&lt;embed src="http://www.youtube.com/get_player" type="application/x-shockwave-flash"width="320" height="266" bgcolor="#FFFFFF"flashvars="flvurl=http://v22.nonxt4.googlevideo.com/videoplayback?id%3D82e2b698bd739ad4%26itag%3D5%26app%3Dblogger%26ip%3D0.0.0.0%26ipbits%3D0%26expire%3D1331504994%26sparams%3Did,itag,ip,ipbits,expire%26signature%3D8711EE7E8C476656B166F482A27EBE96555429F.2CD273E8A1F26492A0EB82DD5B82EA40A88B6BA4%26key%3Dck1&amp;iurl=http://video.google.com/ThumbnailServer2?app%3Dblogger%26contentid%3D82e2b698bd739ad4%26offsetms%3D5000%26itag%3Dw160%26sigh%3D1yRoqMgk5g-yB051l3w79UK6zmY&amp;autoplay=0&amp;ps=blogger"allowFullScreen="true" /&gt;&lt;/object&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-5163053183634363356?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='enclosure' type='video/mp4' href='http://www.blogger.com/video-play.mp4?contentId=82e2b698bd739ad4&amp;type=video%2Fmp4' length='0'/><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/5163053183634363356/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=5163053183634363356' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5163053183634363356'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5163053183634363356'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/02/three-d-images-of-brains-striatum.html' title='Three D images of Brain&apos;s striatum'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-587788559181573860</id><published>2008-01-17T17:41:00.000-08:00</published><updated>2008-01-17T17:43:48.894-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='En Espanol'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters'/><title type='text'>en Espanol , Alonzo Peters</title><content type='html'>Don Wilkerson, Alonzo Peters, inmunología, AMIE on y yo discutimos la teoría de Quantum, la relatividad, la teología, la armonía, la fisiología del nacrótico y la inmunología tan grandes como cualquier clase de escuela.&lt;br /&gt;&lt;br /&gt; Él era uno de los hombres más brillantes que me encontré nunca. Miraba sobre él mientras que no droga que buscaba como clase de Sócrates que el mundo mataba.&lt;br /&gt;&lt;br /&gt;Hice lo que podría mantenerlo vivo con hospitalizaciones (a pesar de su cheque de AMA hacia fuera en los hospitales con la química de un hombre muerto), y guardándolo el trabajar.Cómo atrevimiento cualquie predicador, profesor, o líder supuesto para preguntar quién he tenido como amigos en Houston.&lt;br /&gt;&lt;br /&gt;Ha sido miope, y concreto así como Pharaseic hacer esto mientras que me golpea con el pie mientras que estoy abajo. La mayor parte de esto se habría podido evitar teniendo la esposa adecuada.Era Don e I en 1979, de que primero discutidos la posibilidad de toda la teoría all-encompassing en medicina como teórico.&lt;br /&gt;&lt;br /&gt;Nuestra relación era muy rara y llenada de fluidez en las discusiones.Tenemos grabaciones video raras disponibles solamente para los socios de las producciones de Peters y los pacientes del centro médico del norte, vía DVD y el CD&lt;br /&gt;&lt;br /&gt;Donaciones&lt;br /&gt;&lt;br /&gt; C and P&lt;br /&gt;POB 14089, Houston Tx. 77221&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-587788559181573860?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/587788559181573860/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=587788559181573860' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/587788559181573860'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/587788559181573860'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/en-espanol-alonzo-peters.html' title='en Espanol , Alonzo Peters'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-8855948044300009749</id><published>2008-01-17T17:36:00.000-08:00</published><updated>2008-01-17T17:40:45.806-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='En Espanol'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters'/><title type='text'>Alonzo Peters, En Espanol</title><content type='html'>English&lt;br /&gt;Spanish&lt;br /&gt;Don Wilkerson, Alonzo Peters, Immunology, AMIEDon and I discussed Quantum Theory, Relativity, theology, harmony , opiate physiology and immunology as great as any school class. He was one of the brightest men I ever met. I looked upon him while not drug seeking as a sort of Socrates that the world was killing.I did what I could to keep him alive with hospitalizations (Despite his AMA check out at the hospitals with a dead man's chemistry), and keeping him working.How dare any preacher, teacher, or so-called leader to question who I have had as friends in Houston. It has been myopic, and concrete as well as Pharaseeic to do this while kicking me while I am down. Most of this could have been avoided by having the right wife.It was Don and I in 1979, that first discussed the possibility of all all-encompassing theory in medicine as theoretical. Our relationship was very rare and filled with fluidity in the discussions.We have rare video recordings available only for the partners of Peters' Productions and the patients of North Medical Center, via DVD and CDDonations toCand P  POB 14089, Houston Tx 77221&lt;br /&gt;&lt;br /&gt;Don Wilkerson, Alonzo Peters, inmunología, AMIEDon y yo discutimos la teoría de Quantum, la relatividad, la teología, la armonía, la fisiología del nacrótico y la inmunología tan grandes como cualquier clase de escuela. Él era uno de los hombres más brillantes que me encontré nunca. Miraba sobre él mientras que no droga que buscaba como clase de Sócrates que el mundo mataba.Hice lo que podría mantenerlo vivo con hospitalizaciones (a pesar de su cheque de AMA hacia fuera en los hospitales con la química de un hombre muerto), y guardándolo el trabajar.Cómo atrevimiento cualquie predicador, profesor, o líder supuesto para preguntar quién he tenido como amigos en Houston. Ha sido miope, y concreto así como Pharaseeic hacer esto mientras que me golpea con el pie mientras que estoy abajo. La mayor parte de esto se habría podido evitar teniendo la esposa adecuada.Era Don e I en 1979, de que primero discutidos la posibilidad de toda la teoría all-encompassing en medicina como teórico. Nuestra relación era muy rara y llenada de fluidez en las discusiones.Tenemos grabaciones video raras disponibles solamente para los socios de las producciones de Peters y los pacientes del centro médico del norte, vía DVD y el CDDonaciones aConstrucción de Cand PAvenida de  POB 14089, Houston Tx. 77221&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-8855948044300009749?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/8855948044300009749/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=8855948044300009749' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8855948044300009749'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8855948044300009749'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/alonzo-peters-en-espanol.html' title='Alonzo Peters, En Espanol'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-1606994004104239408</id><published>2008-01-17T17:22:00.000-08:00</published><updated>2008-01-17T17:36:10.129-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='tutored by Don Wilkerson'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters'/><title type='text'>Don Wilkerson, Alonzo Peters, Immunology, AMIE</title><content type='html'>Don and I discussed Quantum Theory, Relativity, theology, harmony , opiate physiology and immunology as great as any school class. He was one of the brightest men I ever met. I looked upon him while not drug seeking as a sort of Socrates that the world was killing.&lt;br /&gt;&lt;br /&gt;I did what I could to keep him alive with hospitalizations (Despite his AMA check out at the hospitals with a dead man's chemistry), and keeping him working.&lt;br /&gt;&lt;br /&gt;&lt;em&gt;&lt;strong&gt;How dare any preacher&lt;/strong&gt;&lt;/em&gt;, teacher, or so-called leader to question who I have had as friends in Houston. It has been myopic, and concrete as well as Pharaseeic to do this while kicking me while I am down. Most of this could have been avoided by having the right wife.&lt;br /&gt;&lt;br /&gt;&lt;strong&gt;&lt;em&gt;&lt;span style="font-size:130%;"&gt;It was Don and I in 1979, that first discussed the possibility of all all-encompassing theory in medicine as theoretical. Our relationship was very rare and filled with fluidity in the discussions.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;/em&gt;&lt;/strong&gt;We have rare video recordings available only for the partners of Peters' Productions and the patients of North Medical Center, via DVD and CD&lt;br /&gt;&lt;br /&gt;Donations to&lt;br /&gt;Cand P Construction&lt;br /&gt;4650 Lee Ave. St.Louis Mo.&lt;br /&gt;63115&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-1606994004104239408?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/1606994004104239408/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=1606994004104239408' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/1606994004104239408'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/1606994004104239408'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/don-wilkerson-alonzo-peters-immunology.html' title='Don Wilkerson, Alonzo Peters, Immunology, AMIE'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-2764473487992826421</id><published>2008-01-17T17:13:00.000-08:00</published><updated>2008-01-17T17:14:51.037-08:00</updated><title type='text'>Alonzo Peters, Don Wilkerson</title><content type='html'>This is a piece of the puzzle.  don played in my band each Sunday at Pizzazz&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-2764473487992826421?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/2764473487992826421/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=2764473487992826421' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2764473487992826421'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2764473487992826421'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/alonzo-peters-don-wilkerson.html' title='Alonzo Peters, Don Wilkerson'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-2175637644354636078</id><published>2008-01-17T17:03:00.000-08:00</published><updated>2008-01-17T17:08:22.006-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Profession'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters'/><category scheme='http://www.blogger.com/atom/ns#' term='medico-legal'/><category scheme='http://www.blogger.com/atom/ns#' term='quantitative analysis'/><title type='text'>Alonzo Peters, medico-legal, Profession, quantitative analysis</title><content type='html'>Thanks to the internet, I will now escape from my existence as a &lt;strong&gt;&lt;strong&gt;Geisha&lt;/strong&gt;-Doc&lt;/strong&gt;- and progress to a more exclusive form of &lt;em&gt;escort service&lt;/em&gt;.  This will happen befor I graduate from South Texas School of Law and deal with the law's intellectual capacity.  If you can't lick em, ......&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Robert C. Merton, a pioneer of quantitative analysis, introduced&lt;br /&gt;stochastic calculus into the study of finance.A quantitative analyst&lt;br /&gt;is a person who works in the investment industry as a research analyst&lt;br /&gt;applying numerical or quantitative techniques to investment issues.&lt;br /&gt;Similar work is done in most other modern industries, but the work is&lt;br /&gt;not called quantitative analysis. In the investment industry, people&lt;br /&gt;who perform quantitative analysis are frequently called quants.&lt;br /&gt;&lt;br /&gt;According to quantitative analysis Fred Gehm[1], "There are two types&lt;br /&gt;of quantitative analysis and, therefore, two types of quants. One type&lt;br /&gt;works primarily with mathematical models and the other primarily with&lt;br /&gt;statistical models. While there is no logical reason why one person&lt;br /&gt;can't do both kinds of work, this doesn't seem to happen, perhaps&lt;br /&gt;because these types demand different skill sets and, much more&lt;br /&gt;important, different psychologies."&lt;br /&gt;&lt;br /&gt;A typical problem for a numerically oriented quantitative analysis&lt;br /&gt;would be to build or upgrade a model for arbitraging convertible bonds&lt;br /&gt;and the stocks the bonds can be converted into.&lt;br /&gt;&lt;br /&gt;A typical convertible arbitrage model might imply, say, that&lt;br /&gt;convertible bond is objectively under priced compared to the stock&lt;br /&gt;given the price of the convertible bond, the price of the stock, the&lt;br /&gt;convertible bond can be converted into, interest rates and other&lt;br /&gt;factors. An investment manager would implement this analysis by buying&lt;br /&gt;the convertible bond and selling the stock short.&lt;br /&gt;&lt;br /&gt;Information on such techniques can be found on Paul Wilmott's popular&lt;br /&gt;numerical-quant website[2]. Mr. Wilmott is the author of many books on&lt;br /&gt;quantitative analysis and grants a Certificate in Quantitative Finance&lt;br /&gt;to anyone willing to pay a fee and pass certain tests. His books and&lt;br /&gt;certificate program, which are completely typical of this approach,&lt;br /&gt;stress probability theory, stochastic calculus, finite difference&lt;br /&gt;methods and other algebraic techniques. Neither his books nor the&lt;br /&gt;documentation for the certificate program makes any mention of&lt;br /&gt;statistical technique.&lt;br /&gt;&lt;br /&gt;A typical problem for statistically oriented quantitative analyst&lt;br /&gt;would be to build or upgrade a model for deciding which stocks are&lt;br /&gt;relatively expensive and which stocks are relatively cheap. A typical&lt;br /&gt;quant model might include a companies book value to price ratio, it's&lt;br /&gt;trailing earnings to price ratio and other accounting factors. An&lt;br /&gt;investment manager might implement this analysis by buying the&lt;br /&gt;underpriced stocks, selling the overpriced stocks or both.&lt;br /&gt;&lt;br /&gt;The Chartered Financial Analysts Institute[3], which is the largest&lt;br /&gt;trade organization in the investment industry, and which grant's the&lt;br /&gt;CFA certification, stresses the statistical approach to quantitative&lt;br /&gt;analysis in its certification program. The CFA's book Quantitative&lt;br /&gt;Investment Analysis, which makes no mention of numerical analysis,&lt;br /&gt;describes techniques such as hypothesis testing, regression analysis,&lt;br /&gt;and time series analysis.&lt;br /&gt;&lt;br /&gt;Although the original "quants" were concerned with risk management and&lt;br /&gt;derivatives pricing, the meaning of the term has expanded over time to&lt;br /&gt;include those individuals involved in almost any application of&lt;br /&gt;mathematics in finance. An example is statistical arbitrage.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-2175637644354636078?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/2175637644354636078/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=2175637644354636078' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2175637644354636078'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2175637644354636078'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/alonzo-peters-medico-legal-profession.html' title='Alonzo Peters, medico-legal, Profession, quantitative analysis'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-8994088748047488444</id><published>2008-01-16T09:08:00.000-08:00</published><updated>2008-01-16T09:11:36.156-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='North Medical Center'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><title type='text'>En Espanol  por North Medical Center et  Alonzo Peters</title><content type='html'>&lt;a name="5924919215554241181"&gt;&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center_29.html"&gt;Alonzo Peters MD @ North Medical Center&lt;/a&gt;&lt;br /&gt;A todos los pacientes y personal de la FELIZ NAVIDAD del norte del centro médicoFeliz Navidad a nombre del centro médico del norte. Agradezco a todos los pacientes y personal incluyendo el " illegals" , si puede haber tal cosa. Estaba solamente para ti, de que nosotros, incluyendo el personal leal que teníamos, juega unknowingly a Marco Welby Y a Robin Hood. Es el now un aniversario del año de la muerte de mi padre y está en la memoria de lo que él me enseñó de la autosuficiencia para la comunidad como Fahim y siendo paciente con el enemigo que damos te a feliz Chrismas sentido este día.Te deseamos una Feliz Navidad, en el alcohol de resolver nuestra impulsión para ganar humanidad y un mejor cuidado médico para los hispanico pobres, los negros y los blancos que eran " undertreated; por cualquie necessary" de los medios;. Nuestra implicación era extendida de una historia de la implicación. Esta extensión era del trabajo con el " Clarence libre Bradley" como el videographer y músico, ofreciendo nuestras propias lecciones de música en OTO, y trabajando con la justicia para Ida Lee Delaney. Realizamos, donamos e hicimos muchos viajes fuera de la ciudad que aumentaba los números. Tenemos sido miembros de iglesia activos que enseñan a la escuela de domingo y que se realizan en el estribillo masculino. Hemos entrado y nos hemos realizado en viajes médicos del misionario antes de este ensayo. Está en mí que sabe donde está mi padre que encuentro fuerza para confiar en en dios y para consolidar mi relación personal con ÉL. Estas actividades de comunidad todos se han documentado en audio/video y cuadros, y están disponibles a petición, a través de un lifecoach diario que llamamos BIBLEBOOST. (Escribir el pob 14089, Houston Tx 77221 envían $12.00 para dirigir. )No éramos traficantes, e implicado simplemente en narcótico que prescribía. Todo sabes lo que hemos ofrecido en el alcohol de Cristo, incluyendo asistencia médica completa, de vacunaciones, del laboratorio, de ultrasonidos, del asesoramiento y de remisiones incluidas a los especialistas con 10 mandamientos. Podrías traer a CUALQUIERA adentro para este cuidado especialmente tu familia. Teníamos una habitación dental en los trabajos. Ofrecimos las visitas para cinco dólares solamente y proporcionamos visitas de la casa. Había planes con uno de los farmacéuticos para las escuelas y las becas. Los nos odiamos por los que no podrían competir con la calidad y la cantidad de cuidado y de nuestro amor, y que eligieron perseguirnos con el escrutinio legal subsecuente a sus acciones y procesamiento.Sin embargo, en el alcohol de Cristo debemos continuar rogando para el enemigo. Rogar para el DEA, el IRS y sus principales agentes. DIOS todavía está en el trono y la batalla es LA SUYA. He crecido en esta experiencia. No sé él nos bendecirá otra vez, pero en fecha ahora mí he hecho mejor doctor, músico, un padre, investigador médico, un cristiano, un hijo, un hermano y un primo. Esto ahora ha ocurrido en parte estando en la recuperación del tratamiento de uno mismo del desorden bipolar con alcohol y otras sustancias por más de 2 años sobre una base cotidiana. Está restaurando para ver que mis pacientes a que conozco ver un cambio del vigor creciente y esperar en mí. Oh sigo siendo sí " crazy" , loco para ti. Ha sido enlightening mirar cómo hice una parte en el closing de la práctica incluyendo la entrega de mi licencia de practicar la medicina, que era en parte una manifestación de mi locura e ignorancia.Mantenerme por favor tus rezos. Rogar por favor para la invención. ES LA TUYA. Rogar para que prospere y prospere. Está debido a tu patrocinio y los rezos hasta el momento que la informática y la educación médicas avanzadas ha publicado reservan y encontraron las curaciones. Esto está para ti y ésos en el futuro especialmente para otros pacientes anticipados. No engañarte. Sabes quién eres. Es debido a ti que hay esperanza sin importar el resultado de este ensayo. En fecha ahora nosotros estamos negociando una posición más fuerte financieramente y te prometo, yo sufriría toda la traición, pérdida, violencia, mentiras y mala voluntad otra vez para tener 1. la beca del sufrimiento con él y 2. Tener mi mente compuesta para seguirlo y 3. sean firmes en ver la invención a través para proponer una teoría de toda la curación de la enfermedad pues se relaciona con la inflamación. PODEMOS HACER TODAS LAS COSAS .....Te prometo te amo la toda más esta Navidad. Te prometo que ésta es la mi mejor Navidad nunca debido a mi relación con Cristo. Eres parte de mi familia y un día el centro médico del norte se levantará otra vez para proporcionar el mismo nivel de cuidado que tenía en el pasado.Sinceramente,MD de Alonzo Peters713-882-7209pete4doc@hotmail.com&lt;br /&gt;Posted by Alonzo Peters MD at &lt;a class="timestamp-link" title="permanent link" href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center_29.html" rel="bookmark"&gt;2:16 AM&lt;/a&gt; &lt;a class="comment-link" onclick="" href="http://www.blogger.com/comment.g?blogID=5180621467202219568&amp;amp;postID=5924919215554241181"&gt;0 comments&lt;/a&gt; &lt;a title="Edit Post" href="http://www.blogger.com/post-edit.g?blogID=5180621467202219568&amp;amp;postID=5924919215554241181"&gt;&lt;/a&gt;&lt;br /&gt;&lt;a name="8310658787178856491"&gt;&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center.html"&gt;Alonzo Peters MD @ North Medical Center&lt;/a&gt;&lt;br /&gt;Éstos serán los trabajos del futuro como para mi pequeño ahijado colombino que esté de dios y temeroso hizo. La Génesis I no ha olvidado a te ni a tu familia. Ni tener I olvidado mis pacientes del Honduran, de Panamá ni Salvadoreño, ni Mexicano ni Cubano ni Venezuellan. Es para ti en parte que lucho esta lucha contra los individuos que no creyeron que me supusieron tomar el cuidado del hispanico pobre de otros países en los E.E.U.U. Uno era mi propietario que conspiró tenerme quitado de su edificio usar el DEA. Era orgulloso ofrecerte las visitas para $5 así como inmunizaciones y solamente dios será el juez en los estos días pasados de corrupción y de rentabilidadTe amo y esperanza verte pronto.MD de Alonzo Peters&lt;a href="mailto:pete4doc@hotmail.com"&gt;pete4doc@hotmail.com&lt;/a&gt;ver En Espanol en Google Blogger713-882-7209&lt;br /&gt;Posted by Alonzo Peters MD at &lt;a class="timestamp-link" title="permanent link" href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center.html" rel="bookmark"&gt; &lt;/a&gt;&lt;br /&gt;Labels: &lt;a href="http://enesp.blogspot.com/search/label/Alonzo%20Peters%20MD" rel="tag"&gt;Alonzo Peters MD&lt;/a&gt;, &lt;a href="http://enesp.blogspot.com/search/label/En%20espano%3B" rel="tag"&gt;En espano;&lt;/a&gt;&lt;br /&gt;&lt;a name="4622962512822238883"&gt;&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md.html"&gt;Alonzo Peters MD&lt;/a&gt;&lt;br /&gt;Fijar por favor tu información después de tocar las producciones del Peters. Levantará el frentepágina. Esto permite que avances tu información a la información médica y ahora robótica.Estamos reforzando el Info en un esfuerzo para avanzar los campos médicos y robóticos.Lo que sigue da la evidencia de la necesidad de seguir las 2 tecnologías. Esto es de un artículo sobre la robótica de uno mismo-nuevo configuración." La búsqueda para las estructuras robóticas de uno mismo-nuevo configuración es inspirada hasta cierto punto por usos previstos tales como misiones espaciales de largo plazo, ésa requiere la ecología robótica independiente económicamente de largo plazo que puede manejar situaciones imprevistas y puede requerir la reparación del uno mismo. Una segunda fuente de inspiración es los sistemas biológicos que uno mismo-se construyen fuera de un repertorio relativamente pequeño de bloques huecos de nivel inferior (las células o los aminoácidos, dependiendo de la escala del interés). Esta arquitectura es la base capacidad de los sistemas biológicos' de adaptarse físicamente, crece, cura, e incluso réplica del uno mismo - las capacidades que serían deseables en muchos systems." dirigidos;¿Cómo combate ellos manzanas Charlene?&lt;br /&gt;Posted by Alonzo Peters MD &lt;br /&gt;&lt;a class="blog-pager-older-link" id="Blog1_blog-pager-older-link" title="Older Posts" href="http://enesp.blogspot.com/search?updated-max=2007-12-29T01%3A56%3A00-08%3A00&amp;amp;max-results=7"&gt; &lt;/a&gt;&lt;br /&gt;Subscribe to: &lt;a class="feed-link" href="http://enesp.blogspot.com/feeds/posts/default" target="_blank" type="application/atom+xml"&gt; &lt;/a&gt;&lt;br /&gt;Blog Archive&lt;br /&gt;&lt;a class="toggle" style="COLOR: #999999" href="http://enesp.blogspot.com/?widgetType=BlogArchive&amp;amp;widgetId=BlogArchive1&amp;amp;action=toggle&amp;amp;dir=close&amp;amp;toggle=YEARLY-1167638400000&amp;amp;toggleopen=MONTHLY-1196496000000"&gt;▼ &lt;/a&gt;&lt;a class="post-count-link" href="http://enesp.blogspot.com/search?updated-min=2007-01-01T00%3A00%3A00-08%3A00&amp;amp;updated-max=2008-01-01T00%3A00%3A00-08%3A00&amp;amp;max-results=8"&gt;2007&lt;/a&gt; (8)&lt;br /&gt;&lt;a class="toggle" style="COLOR: #999999" href="http://enesp.blogspot.com/?widgetType=BlogArchive&amp;amp;widgetId=BlogArchive1&amp;amp;action=toggle&amp;amp;dir=close&amp;amp;toggle=MONTHLY-1196496000000&amp;amp;toggleopen=MONTHLY-1196496000000"&gt;▼ &lt;/a&gt;&lt;a class="post-count-link" href="http://enesp.blogspot.com/2007_12_01_archive.html"&gt;December&lt;/a&gt; (8)&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center_2875.html"&gt;Alonzo Peters MD @ North Medical Center and LISTER...&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/las-actividades-de-investigacin.html"&gt;Las actividades de investigación incluyen la mirad...&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center_1696.html"&gt;Alonzo Peters MD @ North Medical Center vs War on ...&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center_4770.html"&gt;Alonzo Peters MD @ North Medical Center&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center_29.html"&gt;Alonzo Peters MD @ North Medical Center&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md-north-medical-center.html"&gt;Alonzo Peters MD @ North Medical Center&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/alonzo-peters-md.html"&gt;Alonzo Peters MD&lt;/a&gt;&lt;br /&gt;&lt;a href="http://enesp.blogspot.com/2007/12/north-medical-center-formerly-713-699.html"&gt;North Medical Center formerly 713-699-4800 now 713...&lt;/a&gt;&lt;br /&gt;&lt;a class="quickedit" title="Edit" onclick="'return" href="http://www.blogger.com/rearrange?blogID=5180621467202219568&amp;amp;widgetType=BlogArchive&amp;amp;widgetId=BlogArchive1&amp;amp;action=editWidget" target="configBlogArchive1"&gt;&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-8994088748047488444?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/8994088748047488444/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=8994088748047488444' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8994088748047488444'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8994088748047488444'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/en-espanol-por-north-medical-center-et.html' title='En Espanol  por North Medical Center et  Alonzo Peters'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-2521385313722134248</id><published>2008-01-16T08:21:00.000-08:00</published><updated>2008-01-16T08:24:24.584-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='cytokines'/><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><title type='text'>CYTOKINE NEWS</title><content type='html'>Update on 1-16-08 from&lt;br /&gt;THURSDAY, DECEMBER 27, 2007&lt;br /&gt;&lt;br /&gt;&lt;strong&gt;www.advancedmedinfo.com now with 411 on robotics&lt;/strong&gt;&lt;br /&gt;&lt;br /&gt;Please post your information after touching the Peters' Productions. It will pull up the front&lt;br /&gt;page. This allows you to advance your information to medical and now robotic information.&lt;br /&gt;We are beefing up the info in an effort to advance both the medical and robotic fields.&lt;br /&gt;&lt;br /&gt;The following gives evidence of the necessity of following the 2 technologies. This is from an article on self-reconfiguring robotics.&lt;br /&gt;&lt;br /&gt;"The quest for self-reconfiguring robotic structures is to some extent inspired by envisioned applications such as long-term space missions, that require long-term self-sustaining robotic ecology that can handle unforeseen situations and may require self repair. A second source of inspiration are biological systems that are self-constructed out of a relatively small repertoire of lower-level building blocks (cells or amino acids, depending on scale of interest). This architecture underlies biological systems’ ability to physically adapt, grow, heal, and even self replicate – capabilities that would be desirable in many engineered systems."&lt;br /&gt;&lt;br /&gt;How bout them apples Charlene?&lt;br /&gt;&lt;br /&gt;A. Peters MD&lt;br /&gt;713-882-7209&lt;br /&gt;pete4doc@hotmail.com&lt;br /&gt;POSTED BY ALONZO PETERS MD AT 5:06 PM&lt;br /&gt;0 COMMENTS:&lt;br /&gt;Post a Comment&lt;br /&gt;LINKS TO THIS POST&lt;br /&gt;Alonzo Peters MD creator of CYTOKINE NEWS&lt;br /&gt;CYTOKINE NEWS Thursday, December 27, 2007 www.advancedmedinfo.com now with 411 on robotics Please post your information after touching the Peters' Productions. It will pull up the frontpage. This allows you to advance your information ...&lt;br /&gt;Posted byAlonzo Peters MD atJanuary 6, 2008 5:31 PM&lt;br /&gt;Create a Link&lt;br /&gt;Older Post Home&lt;br /&gt;Subscribe to: Post Comments (Atom)&lt;br /&gt;BLOG ARCHIVE&lt;br /&gt;• ▼ 2007 (4)&lt;br /&gt;o ▼ December (4)&lt;br /&gt; www.advancedmedinfo.com now with 411 on robotics&lt;br /&gt; To all Patients and Staff of North Medical Center...&lt;br /&gt; IL10&lt;br /&gt; Inflammation or Lack Thereof&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;ALONZO PETERS MD FAAFP*&lt;br /&gt;* FELLOW AMERICAN ACADEMY OF FAMILY PRACTICE CONTACT : PETE4DOC@HOTMAIL.COM 713-882-7209&lt;br /&gt;AML –ACUTE MYELOGENOUS LEUKEMIA&lt;br /&gt;(CANCER), COAGULATION, AND BIPOLAR DISORDERS,&lt;br /&gt;AS EXAMPLES OF IMMUNE DYSFUNCTION AS WELL AS&lt;br /&gt;FACTORS ASSOCIATED WITH NATURAL ANTI-IFLAMMATORY FUNCTION PART OF ADVANCED MEDICAL INFORMATIC AND EDUCATION’S&lt;br /&gt;AMIE TM&lt;br /&gt;JUSTIFICATION&lt;br /&gt;AN ARGUMENT AND MEDICAL MANIFESTO OF ALL PHYSIOLOGY/PATHOPHYSIOLOGY AS RELATIVE TO A PROPOSED&lt;br /&gt;CYTOKINE PHYSIOLOGIC ANTIINFLAMMATORY CASCADE WHICH ARTICULATES WITH HERETOFORE KNOWN UREA, GLYCOLYTIC, RESPIRATORY, TCA, GLUTATHIONE CHAINS/CYCLE AS AN AID TO THE CITIZENS OF THE USA AND WORLD IN DISEASE PREVENTION AND TREATMENT&lt;br /&gt;&lt;br /&gt;BACKGROUND 12-03-07&lt;br /&gt;&lt;br /&gt;WE CLASSICALLY LOOKED AT INFLAMMATION AS DOLOR, RUBOR, CALOR AND LOSS OF FUNCTION. YET WITHOUT KNOWING THE ACTUAL FUNCTION OR PHYSIOLOGY OF THE ‘FLAME” IN INFLAMMATION WE WERE AT LOSS TO KNOW SOME OF ITS DYSFUNCTION IN INFLAMMATION. CYTOKINES, AKA INTERLEUKINS –ILS(1), AND THEIR RECEPTORS INCLUDING, IL10 (INTERLEUKIN 10) , IL6 , IL8, TNF (TUMOR NECROSIS FACTOR)1, ALL APPEAR TO BE INVOLVED IN AML AND CANCER IN GENERAL AS WELL AS MANY OTHER PROCESSES WHICH LEAD TO DISEASE (4). AS YET CYTOKINES AND THEIR RECEPTORS HAVE NOT BEEN RELATED TO ALL NORMAL PHYSIOLOGIC PROCESSES INCLUDING CONCEPTION AND ALL DISEASE. CYTOKINES AND THEIR RECEPTORS HAVE BEEN RELATED TO A MODEL (SEE BELOW) OF AN INVENTED PATHOPHYSIOLOGY OF INFLAMMATORY MANIFESTATIONS AND PROCESS (IMPAY) . THIS IN ESSENCE ORIGINALLY RELATED ONLY A LIMITED NUMBER OF DISEASES TO A PATHOPHYSIOLOGIC INFLAMMATIORY CASCADE AS BEING RESPONSIBLE FOR THE CONSEQUENCES OF ONLY A FEW DISEASES INCLUDING AML,MS AND LUPUS..&lt;br /&gt;&lt;br /&gt;ON THE OTHER HAND, A SOFTWARE THAT RELATES THE IMPAY MODEL WITH THE KNOWN PHYSOLOGY OF THE NEURO-HUMERAL-IMMUNE ( NHI)(5) FUNCTION WAS LATER NAMED AMIE TM. ( A PRODUCT OF PETERS’ PRODUCTION AND C AND P CONSTRUCTION). THIS COORDINATION OF AMIE TM, NHI AND HERETOFORE ESTABLISHED METABOLIC CYCLES INCLUDING KREBS, GLYCOLYTIC, RESPIRATORY, GLUTATHIONE UREA, ENDOCRINE ALONG WITH NEWLY DISCOVERED HUMAN GENOME PROJECT (INCLUDING MICRO RNA) ALLOWS FOR THE LUMPING OF ALL MEDICAL DATA INTO A QUERY DATA-BASE FOR COMPARISON AND CRITIQUE OF POTENTIAL EXACERBATING AND CURATIVE VARIABLES. THIS IS MADE POSSIBLE ONLY THROUGH COMPUTERS AND SOFTWARE. WE HAVE INVENTED THE SOFTWARE AND PROPOSE A NEW MODEL WHICH INTEGRATES THE AFOREMENTIONED TO ALL DISEASE AND NORMAL PHYSIOLOGY OF THE INFLAMMATORY PROCESS WHICH SOMETIMES DOES NOT RESULT IN INFLAMMATION.&lt;br /&gt;&lt;br /&gt;PART OF THIS INTEGRATION ACKNOWLEDGES CYTOKINE PHYSIOLOGY, ACTION AND FUNCTION AS A TYPE OF HORMONE. A CYTOKINE APPEARS TO BE SIMILAR TO THE ENDOCRINE HORMONE’S (6) IN 1. STIMULATING A RECEPTOR, 2. RECEPTOR-CYTOKINE MOVEMENT TOWARDS THE NUCLEUS AND 3. SUBSEQUENTLY STIMULATION OF TRANSCRIPTION AND TRANSLATION. THUS AMIE TM SUPERCEDES ALL PREVIOUS MEDICAL KNOWLEDGE IN INCORPORATING NEWLY DISCOVERED PRINCIPLES MEASURED IN NANOMOLER QUANTITIES AS CYTOKINES (INTERCHANCHABLY REFERRED TO AS INTERLEUKINS IL-X) AND THEIR RECEPTORS INTO A PARADIGM OF A HYPOTHESIZED INTEGRATIVE CHAIN. IF F GONE AWRY THE MODEL RESULTS IN DIS-EASE INCLUDING PSYCHIATRIC(7).&lt;br /&gt;&lt;br /&gt;THE MOTIVATION AND COURAGE FOR DISCOVERING THE POSSIBILITIES OF CURES FROM OTHER SOURCES INCLUDED JAMES FREDRICK JONES DEATH OF LEUKEMIA, CHILDHOOD BUDDIES LEATHA MAYES CASSANDRA WILLIAMS EDWIN TEMPLE’S DEATHS FROM LUPUS / MS AND LAST BUT NOT LEAST THE LEONARD MOISES DEATH FROM RENAL CELL CARCINOMA .&lt;br /&gt;&lt;br /&gt;IN SUMMARY AMIE TM IS TRIPARTITE,3D AND INVOLVES 1. A PHYSIOLOGIC MODEL OF INFLAMMATION INVOLVING THE NORMAL PHYSIOLOGY OF INFLAMMATION PROPOSING AN END IN TH1 AND TH2 MANIFESTATIONS OF NORMAL PHYSIOLOGIC AND PATHOPHYSIOLOGIC NATURE 2. AN ABBREVIATION DATA BASE 3. A DIALECTIC QUERY CENTERED DATABASE ASSIMILATING AND QUESTIONING THE TOTALITY OF PRE-EXISTING BIOCHEMICAL, CHEMICAL, PHYSICS, PHYSIOLOGIC, MATHEMATICAL, LINGUISTIC, EASTERN/AFRICAN MEDICAL AND INDEX MEDICUS DATA.&lt;br /&gt;&lt;br /&gt;THIS IN ESSENCE IDENTIFIES CONTRADICTIONS AND ELIMINATES POTENTIAL DUPLICATED AND ERRONEOUS DATA. IT ALSO SHOWS THE IMPORTANCE OF A CISION OF THE CIC - INFLAMMATORY CASCADE INTO A TH1 (PREDOMINANTLY CELLULAR INFLAMMATORY NOMENCLATURE RESPONSE (COMPARE TO CATABOLIC) OF IL1, IL6 AND TNF DIVISION AND A TH2 (IL4. IL10) DIVISION OF MAINTENANCE AND SPECIFICITY VIA ANTIBODIES AND ALLERGY (COMPARE TO ANABOLIC)&lt;br /&gt;ORIGINAL CYTOKINE CASCADE OF INFLAMMATION AND ITS CONSEQUENCE&lt;br /&gt;IMPAY MODEL+ AVAILABLE TO EXPAND&lt;br /&gt;&lt;br /&gt;HAVE YOU EVER HEARD OF CYTOKINES AND NORMAL BODY FUNCTIONS?&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-2521385313722134248?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/2521385313722134248/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=2521385313722134248' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2521385313722134248'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2521385313722134248'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/cytokine-news.html' title='CYTOKINE NEWS'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-2207739160688560953</id><published>2008-01-14T15:47:00.000-08:00</published><updated>2008-01-14T15:54:02.146-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Drug war'/><title type='text'>A series of posts from drug war news</title><content type='html'>Pain Medicine: Advocacy Group to Challenge Controlled Substances Act In Lawsuit Aimed at Protecting Physicians, Patients&lt;br /&gt;&lt;br /&gt;Haysville, Kansas, physician Dr. Stephen Schneider and his nurse wife, Linda Schneider, were arrested on a 34-count federal indictment last month for allegedly improperly prescribing opioid pain medications.  The Schneiders are only the latest pain management health care providers to fall victim to the federal government's war against prescription drug abuse and diversion, and now a leading pain relief advocacy group is vowing to take the government to court to block further harassment of physicians and the pain-ridden patients who rely on them.&lt;br /&gt;Last Friday, the &lt;a href="http://www.painreliefnetwork.org/" target="_blank_"&gt;Pain Relief Network&lt;/a&gt; announced it will seek a civil injunction barring the Justice Department from prosecuting the Schneiders. But the lawsuit&lt;strong&gt; could have much broader implications than the couple's freedom&lt;/strong&gt;. It will argue that the way the federal Controlled Substances Act is&lt;strong&gt; applied to doctors and patients is unconstitutional&lt;/strong&gt;.&lt;br /&gt;"I want a judge to take a look at this and see if the United States has authority to prosecute," Pain Relief Network head Siobhan Reynolds said during a &lt;a href="http://www.kansas.com/457/story/272206.html" target="_blank_"&gt;press briefing&lt;/a&gt; last Friday. Reynolds cited a ruling in a similar case that such prosecutions give the government unrestrained power to interfere in the doctor-patient relationship.&lt;br /&gt;The real victims of the government's crackdown on the Schneiders and other health care professionals prescribing opioid pain medications are patients, said Reynolds. "These patients are in real harm's way," Reynolds said. "They are being attacked by the Department of Justice."&lt;br /&gt;While some of Dr. Schneider's former patients have filed malpractice lawsuits claiming they became addicted because of his prescribing, other patients said he had been a godsend and that they are suffering now without him.&lt;br /&gt;One was Jamie McGuire, 49, who had been receiving pain meds for severe arthritis in his spine, hips, and shoulders resulting from an auto accident. Since Schneider was jailed, he has been unable to even get a referral to another doctor. "I think they railroaded him," he said of the prosecution. McGuire told reporters he is almost out of pain medication and his situation is dire. "If they don't do something, I will take myself out," McGuire said.&lt;br /&gt;Another patient, Martin Beatty, 46, also showed up to support his doctor. He said he opted for a regime of pain meds rather than surgery or steroids after falling from a roof 12 years ago and had been a patient of Schneider's for three years. He admitted being dependent on his pain meds, but said that shouldn't matter. "Addiction doesn't mean I am going to be a bad person," Beatty said. Now he worries about going through withdrawal without being under a physician's care.&lt;br /&gt;This week, patients and advocates continued to fight for Dr. Schneider, who, along with his wife, remains jailed. They gathered at his offices to show support and sign petitions, one to join the federal lawsuit, the other to keep the Kansas Board of Healing Arts from moving to suspend his license. According to Reynolds, the clinic will be forced to close because the physician assistants now writing prescriptions are doing so under the auspices of working for a clinic owned by a licensed physician. Other doctors who once practiced at the clinic have been run off by fears of federal prosecution, she said.&lt;br /&gt;"Right now we are calling on the medical board to refrain from joining in this attack on this clinic. This clinic has been hobbled by the Justice Department. These patients are living in mortal fear," Reynolds said.&lt;br /&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9338"&gt;Hey Uncle Sam, leave my dr alone&lt;/a&gt;Comment posted by &lt;a href="http://stopthedrugwar.org/user/hippiemommaida"&gt;hippiemommaida&lt;/a&gt; on Fri, 01/11/2008 - 11:38am&lt;br /&gt;I can see the distress the patients are going thru. I suffer extreme pain and prefer using marijuanna instead of using the vicodin. I have arthritis in hips, back knees, neck, wrist, hands and feet. With the use of marijuanna, I can get up and atleast attempt to accomplish something. And my attitude is better. I worry every day that the feds will arrest my 215 dr. Now at least I am safe from the local cops.&lt;br /&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9350"&gt;Controlled Substances Act&lt;/a&gt;Comment posted by Anonymous on Fri, 01/11/2008 - 12:46pm&lt;br /&gt;"some of Dr. Schneider's former patients have filed malpractice lawsuits claiming they became addicted because of his prescribing, other patients said he had been a godsend and that they are suffering now without him."&lt;br /&gt;These so-called former patients who claim to have become addicted and are filing malpractice lawsuits are nothing but SCAM ARTISTS!!&lt;br /&gt;Physical dependence on opioid's is a minor side effect that is easily overcome by gradually decreasing the dosage once the patient has recovered and the pain level has abated. Example: if a patient were taking 60 milligrams of oxycodone per day following surgery, and is now recovering, but has developed a physical dependence on the medicine, they can decrease the dosage to 30 milligrams for several days. Then 15 milligrams for a few days. Then 5 milligrams. Now that the patient is taking one percoset a day it's easily managed. Now go 48 hours. Then go seven days. They now have no physical dependence on the medicine.&lt;br /&gt;I support the "Pain Relief Network" and believe they should win their legal battle.&lt;br /&gt;Good luck to PRN, and thank you DRCnet.&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9350"&gt; &lt;/a&gt;&lt;br /&gt;&lt;a id="comment-9387"&gt;&lt;/a&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9387"&gt;addicted?&lt;/a&gt;Comment posted by &lt;a href="http://stopthedrugwar.org/user/mlang52"&gt;mlang52&lt;/a&gt; on Fri, 01/11/2008 - 6:32pm&lt;br /&gt;You made a good analysis. The other thing might be that most want to punish the doctor for their inability to control their use of their own pain medicine. (the doctor can't go home with every patient, can he?) They think they deserve to get rich (like the doctor) because of it. Most are likely dishonest with their doctor, in the first place! They just see $$$$$! Greed is likely the biggest factor!&lt;br /&gt;From the most part, opiods are the safest drugs for treating pain, both acute and chronic! 16-20,000 people die, each year, from the bleeding compllications alone, of NSAIDS! That has nothing to say about the heart attacks they say the same drugs like it, ( Vioox and others) have caused!&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9387"&gt; &lt;/a&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9353"&gt;What next?&lt;/a&gt;Comment posted by Anonymous on Fri, 01/11/2008 - 12:58pm&lt;br /&gt;It seems the crusaders looking to make names for themselves are willing to lay many lives on the chopping block for their glory in this witch-hunt society, propagated by the federal government bent on liberating us from our liberties. If you good poeple out there don't vote for Ron Paul, this will only be the beginning of a totalitiarian rule depriving us of our blood earned liberties and rights! This is not a joke! This is our last chance to honor the blood of our forefathers....or to spit on it with our fears and ignorance! TRUTH!&lt;br /&gt;D.L. Matkins Sr.&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9353"&gt; &lt;/a&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9355"&gt;Addictive cocaine good, non addictive marijuana bad.&lt;/a&gt;Comment posted by Anonymous on Fri, 01/11/2008 - 1:02pm&lt;br /&gt;Why can't people be allowed to take whatever pain killer they want as long as nobody else gets hurt?&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9355"&gt; &lt;/a&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9369"&gt;Will it ever stop?&lt;/a&gt;Comment posted by Anonymous on Fri, 01/11/2008 - 3:20pm&lt;br /&gt;Maybe this lawsuit will help. It can't make things worse. This is a witch hunt and a usurping of the doctor-patient relationship. I don't know how much schooling a DEA agent has to have but I know they aren't qualified to take this doctor's garbage out. I can't believe the doctor and his wife are still in jail. Have we gotten to the point where a doctor can't get a recognizance bond? These agents are thugs.&lt;br /&gt;&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9369"&gt;&lt;/a&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9373"&gt;Good in Theory&lt;/a&gt;Comment posted by Anonymous on Fri, 01/11/2008 - 3:39pm&lt;br /&gt;The post above that suggests tapering as a way for pain patients to avoid acute withdrawal is technically accurate, but in my experience (as someone who has had multiple surgeries for chronic back pain caused by disk herniation), no doctor has ever offered that option. I was always afraid to ask because I thought such accurate knowledge would identify me as a "drug seeker".&lt;br /&gt;However, if (god forbid) I have a re-occurrence of back problems, or another injury that justifies opioid pain relief, I will insist that the doctor agree to prescribe a tapering regime or I won't accept the initial script.&lt;br /&gt;I guess we'll have to wait and see how that plays out.&lt;br /&gt;BTW, I agree with the contention that those suing the doctor are greedy opportunists. But there are plenty of other people who do suffer through withdrawal after becoming dependent who do not take legal action.&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9373"&gt; &lt;/a&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9379"&gt;What will happen to patients?&lt;/a&gt;Comment posted by Anonymous on Fri, 01/11/2008 - 4:58pm&lt;br /&gt;The real risk here is that all of this doctor's patients will now be forced to find another physician to help them. Good luck with that!!! Most doctors now seem to think that everyone is an addict, or a potential addict. Which is the lesser of the two evils? I choose to take my medication (after three shoulder surgeries that left me disabled) rather than not be able to function at all. If someone has a chronic condition who should care if they are dependant on narcotic medication? I would much rather be "dependant" than to be in excruciating pain all the time. Good luck to this doctor and his wife. We need more docs such as him in the world.&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9379"&gt; &lt;/a&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9402"&gt;health care in America&lt;/a&gt;Comment posted by Anonymous on Sat, 01/12/2008 - 12:24pm&lt;br /&gt;If you don't think your doctor has been intimidated by the DEA, think again. Your doctor's prescriptions should be made on the basis of your health and comfort. But they're not. Even more important, at least for the doctor, is whether the prescriptions conform to a pattern that the DEA finds interesting. No doctor wants to write a prescription that the DEA will find interesting, even if it's the best thing for the patient. It's no fun to be in jail.Typically, doctors don't like being in jail. When a doctor weighs the benefit of your pain relief against the cost of his becoming an object of interest to the DEA, you can expect that your pain will have less weight, and that you will suffer unnecessary pain.&lt;br /&gt;Health care in America: it's about many things, and your health and comfort *may* be one of them. Mostly, though, it's about money and power. It's appalling what America has become. It's time to change course.&lt;br /&gt;&lt;a href="http://stopthedrugwar.org/comment/reply/9933/9402"&gt; &lt;/a&gt;&lt;br /&gt;&lt;a class="active" href="http://stopthedrugwar.org/chronicle/518/stephan_schneider_pain_group_lawsuit_controlled_substances_act#comment-9414"&gt;bupronorphin?&lt;/a&gt;Comment posted by Anonymous on Sat, 01/12/2008 - 7:54pm&lt;br /&gt;Bupronorphin (I'm not sure if that's the correct spelling?) has been found to be very effective in helping people get off opioids. There's a big difference between addiction and dependance. A diabetic, for example, cannot become addicted to insulin.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-2207739160688560953?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/2207739160688560953/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=2207739160688560953' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2207739160688560953'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/2207739160688560953'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/series-of-posts-from-drug-war-news.html' title='A series of posts from drug war news'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-346173964253115304</id><published>2008-01-03T12:51:00.000-08:00</published><updated>2008-01-03T13:35:06.282-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='AMIE'/><category scheme='http://www.blogger.com/atom/ns#' term='Disease cure'/><category scheme='http://www.blogger.com/atom/ns#' term='cytokine dysfuncion'/><category scheme='http://www.blogger.com/atom/ns#' term='Bibleboost'/><category scheme='http://www.blogger.com/atom/ns#' term='Interleukins'/><title type='text'>Investigations into Mitochondrial and Respiratory Chain Dysfunction</title><content type='html'>In our zeal to deal with the tripartate nature of healing of our patients most recently from Beaumont's and Houston's St. Elizatbeth's Hospitals, VA, Methodist, St. Lukes, Citizen's General, Doctor's Airline , Southwest Memorial, Ross Avenue Medical in Dallas, and Riverside in Houston, we are never amazed at what new things God reveals through the internet.&lt;br /&gt;&lt;br /&gt;This information is meaningless unless assimilated into a logistical intelligent, retrieval system to be compared to other data that initially may not seem to be related. This has occurred with AMIE. A model was necessary at first and the abbreviation then dialectic query based artificially intelligent system flowed from it allowing a perpetuation of humility with new things discovered.&lt;br /&gt;&lt;br /&gt;The newest "discovery" of sorts relating all disease to an inflammatory paradigm was the discovery of 1. cytokine involvement in the conception process 2. cytokine involvement in the in utero process and 3 cytokine involvement in the normal functioning process of homeostasis. These were all predicated on the "absence" of inflammatory (dysfunction) which classically would have been the sign of the nanomolar abnormalities, that brought the dysfunction to our attention. A classic example is the involovement of TNF in Toxic Shock Syndrome, as well as meningococal disease, and the coagulatory , and cardiopulmonary complications of this cytokine when in excess.&lt;br /&gt;&lt;br /&gt;The reason for this is that in western allopathic medicine we classically perceive &lt;strong&gt;inflammation and disease&lt;/strong&gt; as a bad thing in dolor rubor calor and lack of function but in observing its normal functioning components, it gives us superiority of perspective in preventing disease. The observation of a model of the immunologic sytem or chain gives insight into the possibility of cure of all disease. Without the "model" we have no map to find where we got lost because we did not know where we going in the first place.&lt;br /&gt;&lt;br /&gt;Well the absolute latest addition to this immunologic paradigm for all disease is a result of the search made today. &lt;strong&gt;Mitochondrial dysfunction&lt;/strong&gt; is related to cytokine chain dysfunction which eventuates in &lt;strong&gt;respiratory chain dysfunction. &lt;/strong&gt;The disease that started all the questions was Minimal Change Nephrotic Syndrome in Adults, its equivalent in kids and its manifestation in neurologic, renal cardiovascular, respiratory and orthopedic pathologies.&lt;br /&gt;&lt;br /&gt;My struggle is to overcome manifold obstacles to continue this research, so whether you are a boss, individual or patron, please step up to the plate and make donations. We are at the crossroads of greatness. Keep this blogg free and allow us to buy a couple of chickens and about 3 more good people for data input (in each city). A donation of $12oo will give you&lt;br /&gt;domain over any "discovery" in your domain city. There will only be 3 "territorial divisions" from each city who will be awarded exclusivity.&lt;br /&gt;&lt;strong&gt;&lt;/strong&gt;&lt;br /&gt;&lt;strong&gt;I love ya&lt;/strong&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Mail checks to C and P Construction&lt;br /&gt;POB 14089, Houston Tx, 77221&lt;br /&gt;&lt;strong&gt;L A Peters MD&lt;/strong&gt;&lt;br /&gt;&lt;br /&gt;&lt;strong&gt;&lt;/strong&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-346173964253115304?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/346173964253115304/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=346173964253115304' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/346173964253115304'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/346173964253115304'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/investigations-into-mitochondrial-and.html' title='Investigations into Mitochondrial and Respiratory Chain Dysfunction'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-5614733491750435790</id><published>2008-01-01T20:31:00.000-08:00</published><updated>2008-01-01T20:35:46.012-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Alonzo Peters MD'/><title type='text'>Alonzo Peters MD</title><content type='html'>PS . Here i s one great feed&lt;br /&gt;&lt;br /&gt;I love the work in this music not to mention the artistry&lt;br /&gt;&lt;br /&gt;Smile video&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;embed src="http://www.youtube.com/v/beWZd0GOw8Q&amp;amp;rel=" width="425" height="355" type="application/x-shockwave-flash" wmode="transparent"&gt;&lt;/embed&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Bibleboost video&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-5614733491750435790?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/5614733491750435790/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=5614733491750435790' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5614733491750435790'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5614733491750435790'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/alonzo-peters-md.html' title='Alonzo Peters MD'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-8521732825200805586</id><published>2008-01-01T20:06:00.000-08:00</published><updated>2008-01-01T20:29:29.362-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Don Robey'/><category scheme='http://www.blogger.com/atom/ns#' term='Sir Shambling Joe Medwick'/><category scheme='http://www.blogger.com/atom/ns#' term='Purpose'/><title type='text'>kimmylove333@hotmail.com</title><content type='html'>Correct e-mail&lt;br /&gt;&lt;br /&gt;&lt;a href="mailto:kimmylove333@gmail.com"&gt;kimmylove333@gmail.com&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;Kimberly Records&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-8521732825200805586?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/8521732825200805586/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=8521732825200805586' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8521732825200805586'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8521732825200805586'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/kimmylove333hotmailcom.html' title='kimmylove333@hotmail.com'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-7941639286256317145</id><published>2008-01-01T19:22:00.000-08:00</published><updated>2008-01-01T20:03:43.396-08:00</updated><title type='text'>Alonzo Peters MD Soul work.  Good history only Sir Shambling</title><content type='html'>Alonzo Peters MD not Black Top&lt;br /&gt;A little off the &lt;strong&gt;beaten road&lt;/strong&gt;&lt;br /&gt;&lt;strong&gt;&lt;/strong&gt;&lt;br /&gt;&lt;strong&gt;&lt;/strong&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-size:78%;"&gt;The release of the Kimberly 45 in 1985 was a wonderful surprise to all of us who loved Joe, and was a direct result of Black Top’s interest in Texas blues. Their recruitment of sax king Grady Gaines led to several other great artists like pianist Teddy Reynolds and vocalist Big Robert Smith going back into the studio for the first time in many years – and Joe was there too. The version of the superb introspective ballad “&lt;/span&gt;&lt;a href="http://www.sirshambling.com/sounds/joe_medwick/If%20I%20Don"&gt;&lt;span style="font-size:78%;"&gt;If I Don’t Get Involved&lt;/span&gt;&lt;/a&gt;&lt;span style="font-size:78%;"&gt;” on the set doesn’t quite have the power or presence of the 45, especially as the Kimberly has the similarly styled – but not quite as good – “She Fooled Me This Time” on the flip.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;a href="http://www.sirshambling.com/artists/J/joe_medwick.htm"&gt;&lt;span style="font-size:78%;"&gt;Sir Shambling's Deep Soul Heaven - JOE MEDWICK&lt;/span&gt;&lt;/a&gt;&lt;span style="font-size:78%;"&gt;&lt;br /&gt;Joe Medwick Masters (aka Joe Medwick Veasey – and others!)was born on 22 June 1933 and by the late 40 was singing gospel with the Chosen Gospel Singers. ...www.sirshambling.com/artists/J/joe_medwick.htm - 10k - &lt;/span&gt;&lt;a href="http://209.85.173.104/search?q=cache:aaT4WZUd-9IJ:www.sirshambling.com/artists/J/joe_medwick.htm+joe+medwick+veasey&amp;amp;hl=en&amp;amp;ct=clnk&amp;amp;cd=1&amp;amp;gl=us"&gt;&lt;span style="font-size:78%;"&gt;Cached&lt;/span&gt;&lt;/a&gt;&lt;span style="font-size:78%;"&gt; - &lt;/span&gt;&lt;a href="http://www.google.com/search?hl=en&amp;amp;q=related:www.sirshambling.com/artists/J/joe_medwick.htm"&gt;&lt;span style="font-size:78%;"&gt;Similar pages&lt;/span&gt;&lt;/a&gt;&lt;span style="font-size:78%;"&gt; - &lt;/span&gt;&lt;a href="http://www.google.com/"&gt;&lt;span style="font-size:78%;"&gt;Note this&lt;/span&gt;&lt;/a&gt;&lt;span style="font-size:78%;"&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;Sir Shambling,&lt;br /&gt;&lt;br /&gt;Thank you for your mention of Joe Medwick Veasey.&lt;br /&gt;&lt;br /&gt;I wrote you before and you still have erroneous copy.&lt;br /&gt;&lt;br /&gt;I Alonzo Peters III MD, with Pea-squared publishing on Kimberly Records, co-wrote songs with Joe as well as arranged, played saxes, rhythm, engineered it, produced it and in general put it together. We started in Gurlick sound and ended up in Believers studio in Pasadena. We did this while I was on staff at 3 hospitals here in Houston and still delivering children. The city still had their Ku Klux Klan welcome sign up.&lt;br /&gt;&lt;br /&gt;&lt;em&gt;The "world" nature of Houston gave up on Joe and said that he was "burnt out".&lt;/em&gt;  I ignored the upper and lower wanna be pimps and recorded him anyway on a tight divorcee budget. He was my friend. He told me the whole story about Mr Robey, Duke, Peacock and the music business in general that was not mentioned in This Business of Music.    What galls me the most is this perversion of Black History and I am mad.  No one in Houston wants to mention what it took for Don Robey to make it as a Black Man, and the millions that he made except for a state rep or two.&lt;br /&gt;&lt;br /&gt;Calvin Rhodes was a tremendous help with encouragement and hook-ups, as well as I J Gosey, Herman Hawkins, Grady Gaines and Big Robert. Floyd Arceneux had the most beautiful hand (music writing) that any man could see on a manuscript page. I had never met a better combination of instrumentalist and arranger until I met Mr Nelson Mills III, and Jimmy Walker (then with pro Conrad Johnson).&lt;br /&gt;&lt;br /&gt;He never said a bad word about Don Robey. If I had known now what to do with step work we may have been able to keep him. &lt;em&gt;Black Top did not have jack squat to do with reviving&lt;/em&gt; Joe Medwick or helping to produce the songs &lt;em&gt;or record them initally &lt;/em&gt;.   Anyone who tells you this is a liar.  God and Dr. Peters did the initial recording along with the person above. In fact &lt;em&gt;Black Top&lt;/em&gt; still owes me royaties on the songs but it was in part their (second) recording and our direct marketing to Maalaco and &lt;strong&gt;Dave Clark&lt;/strong&gt; ( who knew Joe personally) that Bobbie Bland put it on his &lt;strong&gt;Midnight Run&lt;/strong&gt; album&lt;br /&gt;&lt;br /&gt;It was a very difficult situation with his life choices and al. in the end.  I did not know he had cancer until late, and then we would have had to fight MD Anderson.   I believe he was treated at Ben Taub on an outpatient basis. Nevertheless I have a contract giving me all the publishing on his death. I have not attemped to collect anything, until I found that his daughter was not getting any money.   BMI has sent me my part of the royalties.&lt;br /&gt;&lt;br /&gt;May I receive the calls and letters of any entertainment lawyers who would like to take the case&lt;br /&gt;&lt;br /&gt;Alonzo Peters MD&lt;br /&gt;CEO Kimberly Records&lt;br /&gt;a Division of Peters' Productions&lt;br /&gt;with advancedmedinfo.com&lt;br /&gt;part of a MINISTRY, MUSIC, and Medicine&lt;br /&gt;713-882-7209&lt;br /&gt;for tapes CDs/DVDs&lt;br /&gt;&lt;a href="mailto:kimberly333@hotmail.com"&gt;kimberly333@hotmail.com&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-7941639286256317145?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/7941639286256317145/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=7941639286256317145' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/7941639286256317145'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/7941639286256317145'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/alonzo-peters-md-soul-work-good-history.html' title='Alonzo Peters MD Soul work.  Good history only Sir Shambling'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-5030468080003796966</id><published>2008-01-01T18:19:00.000-08:00</published><updated>2008-01-01T18:25:28.912-08:00</updated><title type='text'>purpose     目的II</title><content type='html'>目的II&lt;br /&gt;&lt;br /&gt;目的私は言う何を知り、次に何を、彼を最初に置くかどの位提携されたGoogleが、人を配置するとき情報の伝達を可能にする、強力にとなる管のために今幸せであり。 これは私が目的だけ現実化することができる教授の大臣の領域を世界の神に拡大するために地図(AMIE)を提供するために省略の質問(言語)およびモデルが付いている弁証的なデータベースの明白な運転者に答えるソフトウェアとの私を賛美したように可能にするが。 これは高度の医療情報および教育を意味する。 目的かのなんと達成! 私は喜んで関係者および投資家を捜している。 これは私達がBibleboostをまた与え続けることを可能にするAMIEの継続的だった資金を可能にする。 _私達持あらゆる病気地図を描のため治療の中3 YEARS.I AM捜ディストリビューター中国、フランス、イギリス、セネガル、エチオピア、南アフリカ共和国、および南のスーダンと同様、ブラジル、ベネズエラ、アルゼンチン、シカゴ、LA、ラスベガス、ニューヨーク、香港、Bejing、ハノイ、フィートLauderdale、セントルイス、または都市たいと思参加inそれ感じ視野の大臣、医学および音楽一手配給権かもしれなあ同様低ように$1200のため各司法権slidingスライド制。 私達は私達が以前持っているように医学の宣教師助けをまた提供する。 リストにあるかどうかリストされていない情報およびapplicationPSのために書きなさい。 2大きい供給はここにある&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Smile video&lt;br /&gt;&lt;embed src="http://www.youtube.com/v/beWZd0GOw8Q&amp;amp;rel=" width="425" height="355" type="application/x-shockwave-flash" wmode="transparent"&gt;&lt;/embed&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Bibleboost video&lt;br /&gt;&lt;br /&gt;&lt;embed src="http://www.youtube.com/v/2XkhXiiVxWI&amp;amp;rel=" width="425" height="355" type="application/x-shockwave-flash" wmode="transparent"&gt;&lt;/embed&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;We love you&lt;br /&gt;&lt;br /&gt;Please visit the following on You Tube Bibleboost.&lt;br /&gt;&lt;br /&gt;That d-dat d-dat d-dat is all folks&lt;br /&gt;www.advancedmedinfo.com&lt;br /&gt;pete4doc@hotmail.com&lt;br /&gt;POB 14089&lt;br /&gt;Houston Tx 77221&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-5030468080003796966?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/5030468080003796966/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=5030468080003796966' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5030468080003796966'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5030468080003796966'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2008/01/purpose-ii.html' title='purpose     目的II'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-8295226332677785100</id><published>2007-11-07T13:32:00.000-08:00</published><updated>2007-11-07T13:36:04.751-08:00</updated><title type='text'></title><content type='html'>tgf POSTING&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;TGF-Beta&lt;br /&gt;&lt;br /&gt;TNF&lt;br /&gt;J Imm/140/2312&lt;br /&gt;Espevik/87&lt;br /&gt;reciprocal activation/regulation LAK activity&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=93"&gt; &lt;/a&gt;&lt;br /&gt;&lt;br /&gt;VIP&lt;br /&gt;&lt;br /&gt;Fed Proc/37/657&lt;br /&gt;Giachetti/78&lt;br /&gt;Leidi/Robbins/88Endocrine/122/1652,Meigan G/88,Endocrine/123/1098,Fernande,89,Endocrine/125/1991,Sasaki/89,J Clin End Metabol/68/180?,Suhr/89,Mol End/3/1693&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=168"&gt; &lt;/a&gt;&lt;br /&gt;MAP&lt;br /&gt;response to infections such as Reckettsia riketsii&lt;br /&gt;&lt;br /&gt;J Pharm Science/91/1-7&lt;br /&gt;Li, JD/03&lt;br /&gt;This article highlights the novel takeover of a host cells respiratory cell netword&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=364"&gt; &lt;/a&gt;&lt;br /&gt;3-ab&lt;br /&gt;NAD+/ATP?&lt;br /&gt;PARP&lt;br /&gt;brain res/829/46&lt;br /&gt;takahashi/99&lt;br /&gt;other inhib act to diminish stroke/Takahashi/99/inflamm dis/Chiarugi/00/circ shock/Mcdonald/00&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=425"&gt;&lt;/a&gt;receptor response to/exercise/inflammation/histamine/lactic acid/ Mg+2/bradykinin/K+/adenosine/H+&lt;br /&gt;Dilation/arteriolar/tissue blood flow&lt;br /&gt;sympathetic vasoconstriction at arteriolar level/ except via autoregulation&lt;br /&gt;Clin Phys mad rediculously simple/3d ed/14&lt;br /&gt;goldberg, stephen/99&lt;br /&gt;This book has quite a few excellent drawingsand does make phys rediculously simple&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=517"&gt; &lt;/a&gt;&lt;br /&gt;&lt;br /&gt;chemical carcinogens&lt;br /&gt;Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride&lt;br /&gt;&lt;br /&gt;wik&lt;br /&gt;&lt;br /&gt;Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=884"&gt;&lt;/a&gt;&lt;br /&gt;CD25&lt;br /&gt;tolerance/ self ags&lt;br /&gt;autoimmunity if system is intact&lt;br /&gt;J Immunol./155/1151–64&lt;br /&gt;Sakaguchi S/ Sakaguchi N/Asano M,/95&lt;br /&gt;Sakaguchi S, Sakaguchi N, Asano M, et al. Immunological self-tolerance maintained by activated T-cells expressing IL-2 receptor alpha-chain (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune-diseases. J Immunol. 1995/155:1151–64.&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=905"&gt; &lt;/a&gt;&lt;br /&gt;Initiator&lt;br /&gt;Prod / Activ&lt;br /&gt;Prod / Activ&lt;br /&gt;Jnl / Vol / Pg&lt;br /&gt;Author / Yr&lt;br /&gt;Misc / Vol / Ed&lt;br /&gt;Functions&lt;br /&gt;LAK cell&lt;br /&gt;TGF-B reciprocal activation/regulation via&lt;br /&gt;&lt;br /&gt;J Imm/140/2312&lt;br /&gt;Espevik/87&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=94"&gt; &lt;/a&gt;&lt;br /&gt;LGL-NK - LAK&lt;br /&gt;IL2 mediated NK - LAK conversion&lt;br /&gt;IL4/cAMP inhibition/(or)&lt;br /&gt;j clin inves/85/6/1990&lt;br /&gt;blay jy/90&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=576"&gt; &lt;/a&gt;&lt;br /&gt;LGL-NK - LAK&lt;br /&gt;IL2 mediated NK - LAK conversion&lt;br /&gt;IL4/cAMP inhibition/(or)&lt;br /&gt;j clin inves/85/6/1990&lt;br /&gt;blay jy/90&lt;br /&gt;&lt;br /&gt;megakaryocyte&lt;br /&gt;IL8&lt;br /&gt;&lt;br /&gt;Br J Haematol. /(3)/509-16.&lt;br /&gt;higuchi, T/97&lt;br /&gt;ito search&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=703"&gt; &lt;/a&gt;&lt;br /&gt;Initiator&lt;br /&gt;Prod / Activ&lt;br /&gt;Prod / Activ&lt;br /&gt;Jnl / Vol / Pg&lt;br /&gt;Author / Yr&lt;br /&gt;Misc / Vol / Ed&lt;br /&gt;Functions&lt;br /&gt;ornithine&lt;br /&gt;LAK activity&lt;br /&gt;NK cell activity/MS outcome&lt;br /&gt;cell immun.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=48"&gt; &lt;/a&gt;&lt;br /&gt;L-NAME / IL2/ NK cell&lt;br /&gt;LAK cells&lt;br /&gt;adeno CA (mice)&lt;br /&gt;J Exp Med/164/814&lt;br /&gt;Phillips JH/Lanier II/86&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=318"&gt; &lt;/a&gt;&lt;br /&gt;tnf&lt;br /&gt;IL2 mediated NK - LAK conversion&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;chouaib/89&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=574"&gt; &lt;/a&gt;&lt;br /&gt;LGL-NK - LAK&lt;br /&gt;IL2 mediated NK - LAK conversion&lt;br /&gt;IL4/cAMP inhibition/(or)&lt;br /&gt;j clin inves/85/6/1990&lt;br /&gt;blay jy/90&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=576"&gt; &lt;/a&gt;&lt;br /&gt;LGL-NK - LAK&lt;br /&gt;IL2 mediated NK - LAK conversion&lt;br /&gt;IL4/cAMP inhibition/(or)&lt;br /&gt;j clin inves/85/6/1990&lt;br /&gt;blay jy/90&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=575"&gt; &lt;/a&gt;hv/Hypovolemia**&lt;br /&gt;thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++&lt;br /&gt;strength in physical realm/+/pride/ego/self&lt;br /&gt;Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/&lt;br /&gt;God/?&lt;br /&gt;+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=674"&gt; &lt;/a&gt;&lt;br /&gt;ornithine&lt;br /&gt;lak activity&lt;br /&gt;arginase/*me/th2 prolif.&lt;br /&gt;cell imm/132/451&lt;br /&gt;&lt;br /&gt;arginase dec ornithine&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=637"&gt; &lt;/a&gt;&lt;br /&gt;Hypovolemia**&lt;br /&gt;thirst/weakness/humility/dependence upon God/state of having not/spiritual strength/cost to Jesus as man/God++&lt;br /&gt;strength in physical realm/+/pride/ego/self&lt;br /&gt;Living Daily 05/02/06/jdg 15:18-19/geographic location/**/+/&lt;br /&gt;God/?&lt;br /&gt;+ Ramath Lehi / compare to/ Jdg 15:15 = antithesis/** Jesus thirsted upon cross at Golgatha/++ Eloi Eloi Lama Sabachthani&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=673"&gt; &lt;/a&gt;&lt;br /&gt;GLYCEROL KINASE&lt;br /&gt;gENE DATA/TGTAATGCTGGTACAAGGCAGCTGGCAACGTTCCCTTCAAGACACAGAGGAGAAATCCAGATCATTCTC/atp MAKER&lt;br /&gt;ATP&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=932"&gt; &lt;/a&gt;&lt;br /&gt;chemical carcinogens&lt;br /&gt;Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride&lt;br /&gt;&lt;br /&gt;wik&lt;br /&gt;&lt;br /&gt;Benzene, kepone, EDB, asbestos, and the waste rock of oil-shale mining /1930s, industrial and tobacco smoke/ including benzopyrene/tobacco-specific nitrosamines s/ nitrosonornicotine, /reactive aldehydes / formaldehyde/ embalming / making plastics. /Vinyl chloride&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=884"&gt; &lt;/a&gt;&lt;br /&gt;Initiator&lt;br /&gt;Prod / Activ&lt;br /&gt;Prod / Activ&lt;br /&gt;Jnl / Vol / Pg&lt;br /&gt;Author / Yr&lt;br /&gt;Misc / Vol / Ed&lt;br /&gt;Functions&lt;br /&gt;crh Receptor - One stimulation&lt;br /&gt;anxiety/anorexia&lt;br /&gt;peace/food intake&lt;br /&gt;brain res rev/15/71&lt;br /&gt;hotta,m/99&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=416"&gt; &lt;/a&gt;&lt;br /&gt;sleep/ condition OSA&lt;br /&gt;significant IL6 elevation in breath condensate&lt;br /&gt;wakefulness&lt;br /&gt;chest/122/4/1162&lt;br /&gt;compagnano, ge/02&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=417"&gt;&lt;/a&gt;tgf-b&lt;br /&gt;&lt;br /&gt;lak&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=583"&gt; &lt;/a&gt;&lt;br /&gt;phloretin&lt;br /&gt;inhibition of muscle pO4lation&lt;br /&gt;glucose uptake by RBC&lt;br /&gt;dbr/13c/295&lt;br /&gt;dbr/86&lt;br /&gt;OXFORD PRESS&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=728"&gt;&lt;/a&gt;tgf-B&lt;br /&gt;&lt;br /&gt;LAK&lt;br /&gt;j imm/140/7312&lt;br /&gt;Espevik/88&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=633"&gt; &lt;/a&gt;&lt;br /&gt;IL2&lt;br /&gt;IL1/cAMP&lt;br /&gt;LGL-LAK/IL4&lt;br /&gt;J clin inves/85/6/1909&lt;br /&gt;Chouaib,S/90&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=634"&gt; &lt;/a&gt;&lt;br /&gt;LT/ET&lt;br /&gt;bA toxins/cAMP&lt;br /&gt;PKA induced T-cell activation via /interuption of /intracellular signaling/MAPK*/MEK associated transcription factors/SAK p38/TCR events&lt;br /&gt;trends immunology/27/9/434&lt;br /&gt;baldari, cosima/06&lt;br /&gt;erk1/erk2*&lt;br /&gt;&lt;a href="http://www.advancedmedinfo.com/WebForm2.aspx?id=771"&gt; &lt;/a&gt;&lt;br /&gt;Initiator&lt;br /&gt;Prod / Activ&lt;br /&gt;Prod / Activ&lt;br /&gt;Jnl / Vol / Pg&lt;br /&gt;Author / Yr&lt;br /&gt;Misc / Vol / Ed&lt;br /&gt;Functions&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-8295226332677785100?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/8295226332677785100/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=8295226332677785100' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8295226332677785100'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/8295226332677785100'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2007/11/tgf-posting-tgf-beta-tnf-j-imm1402312.html' title=''/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-3593220068282150687</id><published>2007-11-07T13:25:00.000-08:00</published><updated>2007-11-07T13:28:39.930-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='FUNUSITIS'/><title type='text'>FUNUSITIS</title><content type='html'>&lt;strong&gt;&lt;span style="font-family:verdana;"&gt;Funisitis &lt;/span&gt;&lt;/strong&gt;&lt;br /&gt;Etiology•mostly bacteria •low virulence organisms , normal flora of vagina or •obvious pathogens such as E.Coli, Mycoplasma, Ureaplasma&lt;br /&gt;Pathogenesis• bacteria ascending from vagina, breaching cervical defenses (mucus plug etc.) • bacterial colonization of intrauterine space through intact or ruptured membranes • maternal and fetal acute inflammatory response,&lt;br /&gt;Epidemiology•clinically evident in 0.5-10% of pregnancies&lt;br /&gt;General Gross Description•membranes and chorionic plate appear cloudy and occasionally have a yellow or green tint •in severe cases the umbilical cord may have small yellow round lesions on its surface which represent foci of PMN's (small abscesses)&lt;br /&gt;General Microscopic Description•Chorioamnionitis: membranes (amnion and chorion + parietal decidua) show neutrophilic infiltrate. PMN's originate from maternal vessels in parietal decidua and migrate into chorion and then amnion. •Chorionitis: chorionic plate shows neutrophilic infiltrate. PMN's orginate from maternal intervillous space and migrate into subchorionic fibrin, chorion itself and then amnion •Funisitis: umbilical cord shows neutrophilic infiltrate. PMN's orginate in the fetal vessels of the umbilical cord and migrate sequentially through the muscular layers of the vessel and then into the Wharton's jelly. •Chorionic vasculitis: chorionic vessels show neutrophils in wall. PMN's originate in the fetal vessels of the chorionic plate and migrate through the walls of the fetal vessels toward the amniotic fluid&lt;br /&gt;Clinical Correlation•associated with preterm birth •only 8-25% of mothers have symptoms such as fever, chills •fetus may have decreased biophysical profile score or abnormal heart rate pattern •can lead to congenital pneumonia, gastroenteritis, menigitis, sepsis although most infants do not have sepsis even with umbilical cord inflammation&lt;br /&gt;References•Gibbs and Sweet "Maternal and Fetal Infections" (chapter 42) in Creasy and Resnik, Maternal Fetal Medicine: Principles and Practices 3rd edition; Philadelphia: WB Saunders, 1994, p644-646.&lt;br /&gt;Funisitis&lt;br /&gt;&lt;br /&gt;&lt;a href="http://esynopsis.uchc.edu/eAtlas/GYN/1486b.htm"&gt;&lt;/a&gt;&lt;br /&gt;Umbilical Vasculitis - acute 10x&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Obstetrics &amp;amp; Gynecology 2007;109:121-127 © 2007 by The American College of Obstetricians and Gynecologists&lt;br /&gt;&lt;br /&gt;ORIGINAL RESEARCH&lt;br /&gt;Maternal Serum Cytokines in Preterm Premature Rupture of Membranes&lt;br /&gt;Amy P. Murtha, MD1, Tammy Sinclair, BSN1, Elizabeth R. Hauser, PhD2, Geeta K. Swamy, MD1, William N. P. Herbert, MD3 and R. Phillips Heine, MD1&lt;br /&gt;From the 1Department of Obstetrics and Gynecology and 2Center for Human Genetics, Duke University Medical Center, Durham, North Carolina; and 3Department of Obstetrics and Gynecology, University of Virginia, Charlottesville, Virginia.&lt;br /&gt;OBJECTIVE: To estimate whether maternal serum interleukin (IL)-6 or granulocyte colony-stimulating factor (G-CSF) obtained daily are elevated in women with preterm premature rupture of membranes who develop funisitis.&lt;br /&gt;METHODS: Daily blood samples were obtained from women with preterm premature rupture of membranes and analyzed for IL-6 and G-CSF by enzyme-linked immunosorbent assay. Funisitis was determined by placental examination. Observations were stratified based on the presence or absence of funisitis and analyzed. Proportional hazards models were used to evaluate time-to-delivery on the basis of diagnostic IL-6 and G-CSF levels, determined by receiver operating characteristic curve analysis.&lt;br /&gt;RESULTS: Of the 107 patients available for analysis, 54 (50%) had evidence of funisitis after delivery. Patients with funisitis were more likely to deliver at an earlier gestational age (28.5 weeks compared with 31.5 weeks, P&lt;.001) and have Medicaid insurance (57% compared with 39%, P=.04). Serum IL-6 and G-CSF were elevated 24 to 48 hours before delivery in women with preterm premature rupture of membranes with funisitis compared with those without funisitis (IL-6, 7.5 compared with 2.8 pg/mL, P&lt;.001; G-CSF, 121.7 compared with 56.9 pg/mL, P=.002). Using values identified by the receiver operating characteristic curve, elevated serum IL-6 in the interval 24–72 hours before delivery was significantly associated with funisitis (P&lt;.03), even after controlling for gestational age and insurance status. CONCLUSION: Maternal serum IL-6 and G-CSF appear to be biomarkers in the identification of women with preterm premature rupture of membranes likely to develop funisitis. &lt;a href="javascript:AL_get(this,"&gt;Immunol Today.&lt;/a&gt; 1989 Sep;10(9):299-304.&lt;br /&gt;&lt;a href="javascript:PopUpMenu2_Set(Menu2686679);" target="_self"&gt;Links&lt;/a&gt;&lt;br /&gt;Comment in:&lt;br /&gt;&lt;a href="http://www.ncbi.nlm.nih.gov/sites/entrez?Db=PubMed&amp;amp;Cmd=ShowDetailView&amp;amp;TermToSearch=2186742&amp;amp;ordinalpos=1&amp;amp;itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus"&gt;Immunol Today. 1990 Mar;11(3):74. &lt;/a&gt;&lt;br /&gt;The cytokine network.&lt;br /&gt;&lt;a href="http://www.ncbi.nlm.nih.gov/sites/entrez?Db=PubMed&amp;amp;Cmd=Search&amp;amp;Term=%22Balkwill%20FR%22%5BAuthor%5D&amp;amp;itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus"&gt;Balkwill FR&lt;/a&gt;, &lt;a href="http://www.ncbi.nlm.nih.gov/sites/entrez?Db=PubMed&amp;amp;Cmd=Search&amp;amp;Term=%22Burke%20F%22%5BAuthor%5D&amp;amp;itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstractPlus"&gt;Burke F&lt;/a&gt;.&lt;br /&gt;The availability of pure recombinant cytokines and molecular probes for their genes has generated an avalanche of scientific information. These data show that cytokines have a broad and overlapping range of cell regulatory activity both in vitro and in vivo. New factors are added to the cytokine list, and new functions reported for existing cytokines, with such frequency that it is difficult to retain an overall picture. With this problem in mind, a large wallchart was designed and was displayed at the second meeting of the British Cytokine Group* whose members pooled their collective knowledge, to list the known biological activities of these cytokines. This wallchart of cytokine activity, now referenced, is reproduced for Immunology Today. It is not a final list: new information and cytokines are continually reported and space has been left for readers to make their own additions. A neutrophil-activating peptide variously named monocyte-derived neutrophil chemotactic factor (MDNCF), neutrophil-activating factor (NAF), lymphocyte-derived neutrophil-activating peptide (LYNAP), which has been suggested as a candidate for interleukin 8 (IL-8), is included.&lt;br /&gt;&lt;br /&gt;ALL COMPLEMENTS OF AMIE&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-3593220068282150687?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/3593220068282150687/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=3593220068282150687' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/3593220068282150687'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/3593220068282150687'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2007/11/funusitis.html' title='FUNUSITIS'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-3139307813663011250</id><published>2007-11-07T13:20:00.000-08:00</published><updated>2007-11-07T13:23:41.968-08:00</updated><title type='text'></title><content type='html'>&lt;strong&gt;AMIE JUSTIFICATION&lt;/strong&gt;&lt;br /&gt;&lt;strong&gt;&lt;/strong&gt;&lt;br /&gt;We  offer animated user friendly introductory interface (Aii) with links to a proprietary Query-Based Dual-Functioning Data-Base with Abbreviations and Data of Artificial Intelligence (QB DF DB AD AI)  This will articulate with existing internet information for a tri-partate access to information.&lt;br /&gt;&lt;br /&gt; In order to offer information from least to greatest detail available we begin with an animated 3d graphic front which articulates with our proprietary data-base which articulates with the www. &lt;br /&gt;                                                  HISTORY / BACKGROUND&lt;br /&gt;&lt;br /&gt; Medical data doubles every 3-5 years.  Sometimes it is duplicated and rarely falsified.  Access and verification of validity and relevance as to treatment utilizing new data as it is being developed is contingent upon the matrix/model  (MM) pertaining to the disease or problem in question.  The MM can have lumper or separator qualities namely finding commonality or differences between each other. A MM allows for lumping.The particular MM that the medically oriented individual was taught and is utilizing allows for the understanding of new concepts or ideas to be incorporated or disguarded in the MM.  Lister went crazy trying to get a group of health care individuals to understand his MM of bacteria in disease and to wash their hands before surgery.&lt;br /&gt;Their  MM of disease was challenged . &lt;br /&gt;&lt;br /&gt;The MM has traditionally  been  suggested as  information published in  textbooks or journals as articles. The MM is based on  existing data and existing data’s relationship to itself.   The relevance to the question itself is of altruistic intercessory quality (AIQ) for the most part in the hands of the researcher or caregiver or patient.&lt;br /&gt;&lt;br /&gt; Current data points to a common Neuro-Humeral- Immune –Genome-INTEGRATED Function (NHIGIF) as it relates to a normal and disease states. Most of us realize that there is a SPIRITUAL coordination/connection/control  associated with  the NHIGIF .&lt;br /&gt;&lt;br /&gt; For example prior to Fleming’s accidental discovery of  PCN we had a leach and let (blood )  drag philosophy of medicine as far as infections are concerned.  It was by back-tracing his actions and reposing the AIQ of bacterial growth that Fleming discovered that mold caused a reduction of growth in a particular  bacterial colonies’ growth.  After he  purified the mold ….voila a cure was developed.  Fleming changed our MM and thought process as to connect one organism’s growth with the decrease of growth  in  another. At this time we were discovering axels or drums, with the wheel being the microscope.  Empiricism or sight-belief connection allowed for  an entity to  “exist”  in our MM and hence be questioned as having or promoting a consequence.&lt;br /&gt;&lt;br /&gt; Later on  researchers discovered that these same organisms that  stopped growing  were in themselves a potential initiator of immune consequece (iiC)  upon  the NHIIF  namely being manifested within our MM as a  disease manifestation (DM) . If left untreated they  led to NHIGIF pathology such as impetigo and glomerulonephritis which are disease leukemia ,MS, DM  are just recently  beginning to be thought of as an iiC consequences upon a MM of normal NHIGIF  and its abnormal consequence being manifested as DM. &lt;br /&gt;&lt;br /&gt;The genetic challenges to the NHIGIF were being studied by Stanislov Burzinski as they related to the genome and as the changes in the genome were iiC s acting upon a NHIGIF . Phenyl-acetate as an active principle can now be thought of as an iiC with   positive consequences upon the NHIGIF.&lt;br /&gt;&lt;br /&gt;A horse is hooked up to a buggy now and someone is thinking of inventing the  horseless carriage. &lt;br /&gt;&lt;br /&gt;The HIV epidemic has done the same thing with respect to helping us  understand  the matrix by which we understand the workings of  NHIGIF.   The decrease in  NHIGIF    seen in HIV consequential DM (AIDS)  have given us insight into the workings of   NHIGIF  in general..  HIV is an iiC which I am sure all readers realize by now,  yet it was by studying the NHIGIF  DM  and reposing the AIQ that the DM of  HIV were realized in perspective to it being an  iiC in relationship  to NHIGIF.  The consequence was that  we gained insight into the workings of the normal  NHIGIF .  The equivalent propeller plane and wired telephone&lt;br /&gt;&lt;br /&gt;A further example if that  the Tuskeegee study was an attempt to study an iiC (syphilis ) and its NHIGIF  DM&lt;br /&gt;&lt;br /&gt; For example  the over-abundance and pathology of NHIGIF   is demonstrated when we die from diabetes as a result of too much tumor necrosis factor (TNF) a normal by-product  of the NHIGIF .  This is   an NHIGIF gone awry.  It is  is on the other end of the continuum of NHIGIF from HIV as were mold and gram positive  bacteria.  I  will hereby predict  that as we  “discover “  iiCs working upon  a  deficient  Human Genome (HG) directed NHIGIF   we will cure all disease in 3 years after the introduction of the  correct MM&lt;br /&gt;&lt;br /&gt; To further clarify we are talking about the “discovery” of  different iiCs as to their effect on normal and abnormal NHIIF!!!   This is the equivalent of the  space shuttle with Wireless transmission of video and audio integrated  broadcasting from space!!!!&lt;br /&gt;&lt;br /&gt; MIs, strokes and cancer’s  are pathologic states which  are  DMs  consequencial to iiCs effect upon an increased or decreased normal  NHIGIF    Another way to put this:  a series of events that causes an iiC to be introduced into the milieu of  NHIGIF will either be normal or  pathologic  (increased or decreased  ) contingent upon 1. amount of iiC,&lt;br /&gt;2. length of time of exposure of iiC and 3. state of the NHIGIF  in relationship to its MM&lt;br /&gt;                                          &lt;br /&gt;                                           &lt;br /&gt;                                              &lt;br /&gt;&lt;br /&gt;                                                  AMIE’s Raison d’Etre&lt;br /&gt;&lt;br /&gt;AMIE is a  Tri-partate TOOL invented for  humanity that allows for insight and comparison/review of iiCs effect upon a proposed MM of normal  NHIGIF in order to illucidate  and prevent /cure DM and to suggest possibilities of iiCs.&lt;br /&gt;&lt;br /&gt;The relationship to normal NHIGIF as  a system  allows us to develop proper preventative, dietary, and treatment perspectives only as they relate to the normal NHIGIF . Prediction : obscure diseases such as leukemias, Lupus, sarcoidosis, and autoimmune diseases such as essential hypertension, MS, thyroid abnormalites arthritis, diabetes will all be illucidated with the proper MM relating to the  NHIGIF  &lt;br /&gt;                                                  &lt;br /&gt;                                                                                  MARKET&lt;br /&gt;&lt;br /&gt;Anyone who is sick has a sick relative a sick loved one or one that they care for.  Researchers and institutions of higher learning after paying a yearly fee ,  will be linked with potential patients who will be paid to participate. by the researchers. This will be contingent upon  outcomes being  likely to be positive.  Higher institutions of learning will add to the data  contingent  upon their research interests.  Individuals of educational pursuit will be allowed access at no charge if they make entries. Doctors, lawyers, patients, media persons, internship/resident physicians, attendings, researchers, fellows if not covered by the institutional fee will pay a yearly fee.  Nursing students, PAs, nurse practitioners, medical assistants, nursing assistants will all be empowered with the availability of information  from least to greatest detail should all have access via their respective institutions of higher learning.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-3139307813663011250?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/3139307813663011250/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=3139307813663011250' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/3139307813663011250'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/3139307813663011250'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2007/11/amie-justification-we-offer-animated.html' title=''/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-5683750877410354351</id><published>2007-11-07T13:03:00.000-08:00</published><updated>2007-11-07T13:20:40.679-08:00</updated><title type='text'>renal</title><content type='html'>The following is a post related to renal physiology and renal failure in particular. &lt;br /&gt;&lt;br /&gt;The current understanding with respect to the potential for renal failure to be improved without transplantation would be to grow a new kidney.  This article deals with the pluripotetent cells that embryologically and genetically relate to functional renal activity post rabdomyolysis.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;    &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Initiator=Renal+Multipotent+Progenitors&amp;amp;Id=Initiator"&gt;Renal Multipotent Progenitors&lt;/a&gt; = Initiator    &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Prod_Activ=It+was+found+that+these+CD24%2bCD133%2b+cells+constitute+the+early+primordial+nephron+but+progressively+disappear+during+nephron+development+until+they+become+selectively+localized+to+the+urin%20"&gt;It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowmans capsule. &lt;/a&gt;     = Product Activity Increased      &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Prod_Active_negative=renal+failure&amp;amp;id=Prod_Activ_negative"&gt;renal failure&lt;/a&gt;      = Product activity Decreased&lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Jnl_vol_pg=journal+american+society+nephrology&amp;amp;id=Jnl_vol_pg"&gt;journal american society nephrology&lt;/a&gt;     = Jnl &lt;br /&gt;     authors- &lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Author_yr=Elena+Lazzeri%2fElisa+Ronconi%2fBenedetta+Mazzinghi%2fCostanza+Sagrinati%2fGiuseppe+Stefano+Netti%2fMaria+Lucia+Angelotti%2fEliana+Parente%2fLara+Ballerini%2fLorenzo+Cosmi%2fLaura+Maggi%2fLoret%20"&gt;Elena Lazzeri/Elisa Ronconi/Benedetta Mazzinghi/Costanza Sagrinati/Giuseppe Stefano Netti/Maria Lucia Angelotti/Eliana Parente/Lara Ballerini/Lorenzo Cosmi/Laura Maggi/Loreto Gesualdo/Mario Rotondi&lt;/a&gt;&lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Misc_vol_ed=+%2fFrancesco+Annunziato%2fEnrico+Maggi%2fLaura+Lasagni%2fMario+Serio%2fSergio+Romagnani%2fGabriella+Barbara+Vannelli&amp;amp;id=Misc_vol_ed"&gt;/Francesco Annunziato/Enrico Maggi/Laura Lasagni/Mario Serio/Sergio Romagnani/Gabriella Barbara Vannelli&lt;/a&gt;        &lt;br /&gt;&lt;br /&gt;                       compliments of&lt;br /&gt;&lt;br /&gt;                                              AMIE&lt;br /&gt;                    advanced medical informatics education&lt;br /&gt;                                                            pete4doc@hotmail.com&lt;br /&gt;Published ahead of print on October 31, 2007Journal of the American Society of Nephrology© 2007 &lt;a href="http://jasn.asnjournals.org/misc/terms.shtml"&gt;American Society of Nephrology&lt;/a&gt;doi: 10.1681/ASN.2007020210&lt;br /&gt;Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure&lt;br /&gt;Elena Lazzeri *, Clara Crescioli *, Elisa Ronconi *, Benedetta Mazzinghi *, Costanza Sagrinati *, Giuseppe Stefano Netti , Maria Lucia Angelotti *, Eliana Parente *, Lara Ballerini *, Lorenzo Cosmi *, Laura Maggi *, Loreto Gesualdo , Mario Rotondi * , Francesco Annunziato *, Enrico Maggi *, Laura Lasagni *, Mario Serio *, Sergio Romagnani *, Gabriella Barbara Vannelli , and Paola Romagnani *1&lt;br /&gt;*Excellence Center for Research, Transfer and High Education for the Development of DE NOVO THERAPIES, and Department of Anatomy, University of Florence, Florence, Department of Biomedical Sciences, University of Foggia, Foggia, and Department of Endocrinology and Internal Medicine, Fondazione S. Maugeri Istituti di Ricovero e Cura a Carattere Scientifico, Pavia, Italy&lt;br /&gt;&lt;br /&gt;                                       Abstract&lt;br /&gt;Bone marrow– and adult kidney–derived stem/progenitor cells hold promise in the development of therapies for renal failure. Here is reported the identification and characterization of renal multipotent progenitors in human embryonic kidneys that share CD24 and CD133 surface expression with adult renal progenitors and have the capacity for self-renewal and multilineage differentiation. It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowman’s capsule. When isolated and injected into SCID mice with acute renal failure from glycerol-induced rhabdomyolysis, these cells regenerated different portions of the nephron, reduced tissue necrosis and fibrosis, and significantly improved renal function. No tumorigenic potential was observed. It is concluded that CD24+CD133+ cells represent a subset of multipotent embryonic progenitors that persist in human kidneys from early stages of nephrogenesis. The ability of these cells to repair renal damage, together with their apparent lack of tumorigenicity, suggests their potential in the treatment of renal failure.&lt;br /&gt;  &lt;br /&gt;Prod / Activ  Decrease       &lt;br /&gt;Jnl / Vol / Pg       &lt;br /&gt;Author / Yr&lt;br /&gt;Misc / Vol / Ed       &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Initiator=Renal+Multipotent+Progenitors&amp;amp;Id=Initiator"&gt;Renal Multipotent Progenitors&lt;/a&gt;     &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Prod_Activ=It+was+found+that+these+CD24%2bCD133%2b+cells+constitute+the+early+primordial+nephron+but+progressively+disappear+during+nephron+development+until+they+become+selectively+localized+to+the+urin%20"&gt;It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowmans capsule. &lt;/a&gt;           &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Prod_Active_negative=renal+failure&amp;amp;id=Prod_Activ_negative"&gt;renal failure&lt;/a&gt;     &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Jnl_vol_pg=journal+american+society+nephrology&amp;amp;id=Jnl_vol_pg"&gt;journal american society nephrology&lt;/a&gt;        &lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Author_yr=Elena+Lazzeri%2fElisa+Ronconi%2fBenedetta+Mazzinghi%2fCostanza+Sagrinati%2fGiuseppe+Stefano+Netti%2fMaria+Lucia+Angelotti%2fEliana+Parente%2fLara+Ballerini%2fLorenzo+Cosmi%2fLaura+Maggi%2fLoret%20"&gt;Elena Lazzeri/Elisa Ronconi/Benedetta Mazzinghi/Costanza Sagrinati/Giuseppe Stefano Netti/Maria Lucia Angelotti/Eliana Parente/Lara Ballerini/Lorenzo Cosmi/Laura Maggi/Loreto Gesualdo/Mario Rotondi&lt;/a&gt;&lt;br /&gt;&lt;a href="http://advancedmedinfo.com/WebForm4.aspx?Misc_vol_ed=+%2fFrancesco+Annunziato%2fEnrico+Maggi%2fLaura+Lasagni%2fMario+Serio%2fSergio+Romagnani%2fGabriella+Barbara+Vannelli&amp;amp;id=Misc_vol_ed"&gt;/Francesco Annunziato/Enrico Maggi/Laura Lasagni/Mario Serio/Sergio Romagnani/Gabriella Barbara Vannelli&lt;/a&gt;        &lt;br /&gt;&lt;br /&gt;&lt;br /&gt;                                              AMIE&lt;br /&gt;                                               advanced medical informatics education&lt;br /&gt;                                                            pete4doc@hotmail.com&lt;br /&gt;Published ahead of print on October 31, 2007Journal of the American Society of Nephrology© 2007 &lt;a href="http://jasn.asnjournals.org/misc/terms.shtml"&gt;American Society of Nephrology&lt;/a&gt;doi: 10.1681/ASN.2007020210&lt;br /&gt;Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure&lt;br /&gt;Elena Lazzeri *, Clara Crescioli *, Elisa Ronconi *, Benedetta Mazzinghi *, Costanza Sagrinati *, Giuseppe Stefano Netti , Maria Lucia Angelotti *, Eliana Parente *, Lara Ballerini *, Lorenzo Cosmi *, Laura Maggi *, Loreto Gesualdo , Mario Rotondi * , Francesco Annunziato *, Enrico Maggi *, Laura Lasagni *, Mario Serio *, Sergio Romagnani *, Gabriella Barbara Vannelli , and Paola Romagnani *1&lt;br /&gt;*Excellence Center for Research, Transfer and High Education for the Development of DE NOVO THERAPIES, and Department of Anatomy, University of Florence, Florence, Department of Biomedical Sciences, University of Foggia, Foggia, and Department of Endocrinology and Internal Medicine, Fondazione S. Maugeri Istituti di Ricovero e Cura a Carattere Scientifico, Pavia, Italy&lt;br /&gt;  Abstract&lt;br /&gt;Bone marrow– and adult kidney–derived stem/progenitor cells hold promise in the development of therapies for renal failure. Here is reported the identification and characterization of renal multipotent progenitors in human embryonic kidneys that share CD24 and CD133 surface expression with adult renal progenitors and have the capacity for self-renewal and multilineage differentiation. It was found that these CD24+CD133+ cells constitute the early primordial nephron but progressively disappear during nephron development until they become selectively localized to the urinary pole of Bowman’s capsule. When isolated and injected into SCID mice with acute renal failure from glycerol-induced rhabdomyolysis, these cells regenerated different portions of the nephron, reduced tissue necrosis and fibrosis, and significantly improved renal function. No tumorigenic potential was observed. It is concluded that CD24+CD133+ cells represent a subset of multipotent embryonic progenitors that persist in human kidneys from early stages of nephrogenesis. The ability of these cells to repair renal damage, together with their apparent lack of tumorigenicity, suggests their potential in the treatment of renal failure.&lt;br /&gt;&lt;br /&gt;A. Peters MD&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-5683750877410354351?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/5683750877410354351/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=5683750877410354351' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5683750877410354351'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/5683750877410354351'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2007/11/renal.html' title='renal'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-4451054004782542172</id><published>2007-09-28T19:15:00.000-07:00</published><updated>2007-09-28T19:16:32.511-07:00</updated><title type='text'></title><content type='html'>TGF-B1 is the center of attraction and will be the key to cancer treatment in the future&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;a peters MD&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-4451054004782542172?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/4451054004782542172/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=4451054004782542172' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/4451054004782542172'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/4451054004782542172'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2007/09/tgf-b1-is-center-of-attraction-and-will.html' title=''/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-4710992583761501713</id><published>2007-09-28T19:12:00.000-07:00</published><updated>2007-09-28T19:14:39.738-07:00</updated><title type='text'></title><content type='html'>The particular entry that we have above can be checked by highligting then copying.&lt;br /&gt;&lt;br /&gt;Place the author and one of the subjects in Googles search with a + sign in between&lt;br /&gt;&lt;br /&gt;a peters MD&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-4710992583761501713?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/4710992583761501713/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=4710992583761501713' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/4710992583761501713'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/4710992583761501713'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2007/09/particular-entry-that-we-have-above-can.html' title=''/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-2280442141051223541.post-6905702248997858430</id><published>2007-09-28T18:57:00.000-07:00</published><updated>2007-09-28T19:04:59.658-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='conception'/><title type='text'>conception</title><content type='html'>This is how the listings occur from an article to a post. What is does is use simple proportions to demonstrate definitions of certain concepts.&lt;br /&gt;Do you see the going up and going down fields? These are help us define certain subjects.&lt;br /&gt;&lt;br /&gt;Initiator Prod / Activ Prod / Activ Jnl / Vol / Pg Author / Yr Misc / Vol / Ed&lt;br /&gt;conception immune reaction activation/TGF-B1/disabling of allergic reaction after fertilization/APC action rejection of foreign components&lt;br /&gt;human conception/live birth Th2/immune reaction activation/TGF-B1/disabling of allergic reaction after fertilization/APC action rejection of foreign components/milagro/Th1 J Reprod Immunol./2/253-65 Robertson/2003 a cytokine present in abundance in seminal plasma, initiates this inflammatory response by stimulating the synthesis of pro-inflammatory cytokines and chemokines in uterine tissues.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/2280442141051223541-6905702248997858430?l=advancedmedinfo.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://advancedmedinfo.blogspot.com/feeds/6905702248997858430/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=2280442141051223541&amp;postID=6905702248997858430' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/6905702248997858430'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/2280442141051223541/posts/default/6905702248997858430'/><link rel='alternate' type='text/html' href='http://advancedmedinfo.blogspot.com/2007/09/conception.html' title='conception'/><author><name>NONEYA</name><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry></feed>
